Introducción a la genética y la biología molecular - PowerPoint PPT Presentation

slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Introducción a la genética y la biología molecular PowerPoint Presentation
Download Presentation
Introducción a la genética y la biología molecular

play fullscreen
1 / 65
Introducción a la genética y la biología molecular
192 Views
Download Presentation
ulric-barnett
Download Presentation

Introducción a la genética y la biología molecular

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. CURSO de VERANO 2009: LA BIOINFORMÁTICA COMO PUENTE ENTRE LA GENÉTICA Y SUS APLICACIONES INDUSTRIALES Y BIOMÉDICAS Introducción a la genética y la biología molecular Dr. Manel Vera Rodríguez (manuel.vera@usc.es)

  2. Breve historia de la genética: • 1865: G.J. Mendel presenta sus experimentos con guisantes que muestran los principios de la herencia • 1888: W. Waldeyer acuña el término de cromosoma • 1900: H. de Vries, C. Correns y E. von Tschermak redescubren la leyes de Mendel • 1905: Bateson da el nombre de genética a la disciplina • 1908: Hardy y Weinberg formulan el principio de la genética de poblaciones • 1910: Morgan descubre la mutación white (ojo blanco) y la herencia ligada al sexo en Drosophila • 1941: G.W. Beadle & E.L. Tatum proponen el concepto 1gen-1enzima • 1944: Avery demuestra que el ADN es el material hereditario • 1953: Watson y F. Crick describen la estructura en doble hélice del ADN • 1958: M.S. Meselson y F.W. Stahl demuestran que la replicación del ADN es semiconservativa • 1968: Okazaky y colaboradores demuestran la síntesis discontínua de la cadena retardada de ADN • 1974: R.D. Kornberg describe la estructura de la cromatina (nucleosomas) • 1978: W. Gilbert acuña los términos intrón y exón • 1986: Saiki, K.B. Mullis y colaboradores describen la Reacción en Cadena de la Polimerasa (PCR) • 1990: Empieza el proyecto Genoma Humano • 1995: Primer organismo unicelular secuenciado: Haemophilus influenzae • 1996-1997: I. Wilmut y K. Campbell clonan el primer mamífero (oveja Dolly) Historia de la genética

  3. Qué es el ADN? Definición: El Ácido DesoxiriboNucleico (ADN) es el portador de la información genética en las células, compuesto por dos cadenas complementarias de nucleótidos enrolladas en una doble hélice, capaz de autorreplicarse y de dirigir la síntesis de ARN. DNA (nomenclatura inglesa): DeoxiriboNucleic Acid

  4. La estructura del ADN • El monómero del ADN es un nucleótido. • Los nucleótidos están formados por un azúcar (desoxi-ribosa), una base nitrogenada y un grupo fosfato. • Los componentes del nucleótido están unidos por fuertes enlaces covalentes (fosfodiester). • Las bases son purinas (Guanina y Adenina) y pirimidinas (Citosina y Timina). • La estructura del ADN está formada por 2 cadenas complementarias. • Las 2 cadenas están orientadas en direcciones opuestas, quedando en cada una un extremo 5’ (fosfato) y un extremo 3’ (hidroxilo). • La unión entre las 2 cadenas se realiza mediante enlaces de hidrógeno entre 2 bases (1 de cada cadena), formando un “par de bases”. • La Adenina se une siempre a la Timina mediante 2 enlaces. La Guanina se une siempre a la Citosina mediante 3 enlaces. • Los grupos hidroxilo libres del fosfato son los que dan una fuerte carga eléctrica negativa y el carácter ácido a la molécula • La molécula de ADN se enrrolla en la forma de una doble hélice. • Por cada 10 pares de bases, la molécula gira 360º. La estructura recuerda a una escalera de caracol.

  5. La estructura del ADN Estructura del ADN

  6. Genes y Genomas • Un gen es un fragmento de ADN que contiene la información necesaria (en forma de secuencia de bases) para codificar la síntesis de una proteína o un ARN. Podemos considerar a un gen como una unidad de información. • No todo el material genético de un organismo está organizado en genes. Existe ADN no codificante. En las células humanas solamente el 3% del ADN da lugar a la síntesis de proteínas • El genoma de un organismo es el conjunto de material genético que contienen sus células.

  7. Tamaño de los genomas • El virus más pequeño contiene poco más de 4.000 pares de bases. Una bacteria contiene como media 5.106 pares de bases (5.000 Kb o 5 Mb) (2 m de longitud). • Como norma general las bacterias (células procariotas) contienen una sola molécula de ADN circular, mientras que las células eucarióticas (animales y vegetales) contienen varias moléculas de ADN lineal organizadas en cromosomas. • Una célula humana contiene 3.000 Mb distribuidas en 46 cromosomas. Cada cromosoma contiene una molécula lineal de ADN.

  8. Tamaño de los genomas

  9. Organización del material genético • El material genético de las células procarióticas se organiza habitualmente en 1 sólo cromosoma que contiene una molécula de ADN circular. • El material genético de las células eucarióticas se organiza en cromosomas. Cada uno está formado por una mólecula de ADN en doble hélice lineal asociado a proteínas básicas (histonas) formando la cromatina. Estructura del cromosoma eucariota

  10. Mitosis Definición:División celular caracterizada por la replicación de los cromosomas y la formación de dos núcleos hijos idénticos entre sí (cariocinesis), seguido de la partición del citoplasma (citocinesis), para formar dos células hijas. Tiene cuatro fases:

  11. Mitosis Animación Mitosis

  12. Cariotipo Definición:ordenamiento de los cromosomas de una célula metafásica de acuerdo a su tamaño y morfología. A: Metacéntricos grandes B: Submetacéntricos grandes C: Submetacéntricos medianos D: Acrocéntricos medianos E: Submetacéntricos pequeños F: Metacéntricos pequeños G: Acrocéntricos pequeños Par sexual Cariotipo humano: 2n= 46 (Diploide= doble dotación cromosómica, cromosomas por pares) 23 pares de cromosomas homólogos

  13. Cariotipo El cariotipo es característico de cada especie

  14. Qué es el ARN? Definición: El Ácido RiboNucleico (ARN) se distingue del ADN por la presencia del azúcar ribosa y la pirimidina Uracilo; incluye ARN mensajero (ARNm), ARN de transferencia (ARNt) y ARN ribosómico (ARNr). También es el material genético de muchos virus, llamados retrovirus. RNA (nomenclatura inglesa): RiboNucleic Acid

  15. Estructura del ARN • El ARN (ácido ribonucleico) contiene ribosa en lugar de desoxi-ribosa. • Está formado por las mismas bases nitrogenadas, excepto la Timina que se sustituye por Uracilo. • El Uracilo es también complementario de la Adenina. • A diferencia del ADN está formado por una única cadena de nucleótidos. • La longitud de la cadena es mucho menor que en el ADN. • Se pueden formar enlaces entre bases complementarias dentro de la misma cadena, lo que origina estructuras tridimensionales complejas.

  16. Tipos de ARN

  17. Dogma fundamental de la biología molecular Cómo es el flujo de información genética en los seres vivos. Tres procesos fundamentales: Replicación Transcripción Traducción ADN ARN PROTEÍNAS Transcripción inversa (retrovirus)

  18. De los genes a las proteínas

  19. La replicación del ADN

  20. La replicación del ADN Conservativa Semiconservativa Dispersiva Esquema Experimentos Meselson y Stahl (1958)

  21. DNA pol ARN cebador La replicación del ADN • Catalizada por una ADN-polimerasa que añade nucleótidos al extremo 3’-OH de la cadena naciente (sentido polimerización= 5’ a 3’). • La ADN-polimerasa necesita un cebador de ARN. • Los nucleótidos se añaden por emparejamiento complementario con las bases de la cadena molde. • Los sustratos, desoxi-ribonucleótido trifosfato (dNTP) se hidrolizan al añadirse, liberando energía para la síntesis del ADN. • Existen diversas proteínas que colaboran en la replicación.

  22. La replicación del ADN

  23. Garret & Grisham. Biochemistry 2ª ed. Saunders College Publishing Transcripción • La síntesis del ARNm la realiza una ARN polimerasa en dirección 5’--> 3’. • Los ribonucleótidos se añaden por emparejamiento complementario con las bases de la cadena molde de ADN. • La presencia de Adenina en el ADN determina la adición de un Uracilo en el ARN.

  24. Transcripción A partir de Curtis, Barnes, Schnek & Massarini. Biología. 7ª ed. Editorial Médica Panamericana

  25. La transcripción en procariotas • Los genes que codifican proteínas involucradas en la misma ruta metabólica suelen presentarse agrupados en el cromosoma, formandooperones, lo que permite la expresión coordinada. • Una región reguladora adyacente al operón, determinasu transcripción- es el“operador”. • Proteínas reguladoras funcionan con los operadores, para controlar la transcripción delos genes.

  26. Garret & Grisham. Biochemistry 2ª ed. Saunders College Publishing La transcripción en eucariotas • La Cromatina limita el acceso de las proteínas reguladoras a los promotores. • Existen factores proteicos que deben reorganizar la cromatina. • Las RNA polimerasas I, II y III transcriben rRNA, mRNA y tRNA, respectivamente. • Las 3 polimerasas interaccionan con los promotores a través de los “factores de transcripción”. • La “TATA box” (TATAAA) es un promotor “consenso”. • Los factores de transcripción reconocen secuencias promotoras específicas e inician la transcripción (algunos factores se unen a secuencias específicas en la región codificante del gen). • Además de promotores, los genes eucariotas tienen “enhancers”, o “upstream activation sequences”.

  27. Estructura del gen eucariota • Los genes eucariotas están divididos en exones (se traducen a aminoácidos) e intrones (no codificantes). • Ejemplos: El gen de la actina tiene un intrón de 309-pb que separa los primeros 3 aminoácidos de los restantes 350. • El gen del colágeno pro-alpha-2 del pollo, mide 40-kb, con 51 exones que suman sólo 5 kb. • Los exones suelen medir entre 45 y 249 bases. • El mecanismo por el que se escinden los intrones y por el que se unen los exones, es complejo y muy preciso (“RNA- splicing”)

  28. Garret & Grisham. Biochemistry 2ª ed. Saunders College Publishing Estructura del gen eucariota Maduración RNAm en eucariotas Transcripción y maduración RNAm

  29. Traducción del mensaje genético • La información contenida en la secuencia de bases del ADN es trasladada o traducida a una secuencia de aminoácidos en una proteína, a través del ARN que actúa como intermediario Garret & Grisham. Biochemistry 2ª ed. Saunders College Publishing

  30. Las proteínas Aminoácidos que forman las proteínas No polar Polar Alcalino Ácido

  31. Las proteínas Aminoácidos que forman las proteínas Aa esenciales (obtenidos de la dieta) No polar Polar Alcalino Ácido

  32. Garret & Grisham. Biochemistry 2ª ed. Saunders College Publishing Síntesis de proteínas • La síntesis transcurre desde el extremo N-terminal al extremo C-terminal. • Los ribosomas leen el ARNm en la dirección 5’--3’. • La traducción tiene lugar en polirribosomas o polisomas. Hay más de un ribosoma traduciendo cada ARNm simultáneamente. • La elongación de la cadena proteica tiene lugar por adición secuencial de aminoácidos al extremo C-terminal. • El ARNt tiene en el extremo 3’ el lugar de unión del aa, y en uno de sus bucles el anticodón complementario al codón del ARNm

  33. Síntesis de proteínas Initiation

  34. El código genético • Cada aminoácido está codificado por una secuencia de 3 nucleótidos en el ARNm llamada codón. • Las combinaciones de las 4 bases tomadas de 3 en 3 originan 64 posibles permutaciones. • Puesto que solamente existen 20 aminoácidos formando parte de las proteínas, el código es redundante o degenerado: existen codones sinónimos. • Existe además un codón que marca el inicio de una proteína y 3 codones que marcan el fin.

  35. El código genético ORIGIN (Ribonucleasa pancreática bovina) 1 ggcagaaact gccttctctc tctcagacat caaactagag acccaggttt ctccagggga 61 gtgcggtcat catggctctg aagtccctgg tcctgttgtc gctgttggtc ctggtgctgc 121 tgctggtgcg ggtccagcct tccctgggca aggaaactgc agcagccaag tttgagcggc 181 agcacatgga ctccagcact tccgctgcca gcagctccaa ctactgtaac cagatgatga 241 agagccggaa cctgaccaaa gatcgatgca agccagtgaa cacctttgtg cacgagtccc 301 tggctgatgt ccaggccgtg tgctcccaga aaaatgttgc ctgcaagaat gggcagacca 361 attgctacca gagctactcc accatgagca tcaccgactg ccgtgagacc ggcagctcca 421 agtaccccaa ctgtgcctac aagaccaccc aggcgaataa acacatcatt gtggcttgtg 481 agggaaaccc gtacgtgcca gtccactttg atgcttcagt gtaggtctct acctaaggcc 541 agagcagcaa gatgcaccac ttcatcacaa aggcacctgc ctctcccctc atgtttcctt 601 gtcctggggg caatagctca agttagttag ggctcttatc tctgcgcacc ttaccagaaa 661 cacacacaca ggattccctg gcatgaaagc aataactcaa gctagttaag tcttctatcc 721 aacccacact tgctcccctg gcctgagtct tgcccctggt ggtttggggg gtgaggagtg 781 ggttgtgagg tgggacctgt gttaaccaaa tcactgcttc tttcaataaa catacttgca 841 accacctgaa aaaaaaaaaa aaaa //

  36. El código genético ORIGIN (Ribonucleasa pancreática bovina) 1 ggcagaaact gccttctctc tctcagacat caaactagag acccaggttt ctccagggga 61 gtgcggtcat catggctctg aagtccctgg tcctgttgtc gctgttggtc ctggtgctgc 121 tgctggtgcg ggtccagcct tccctgggca aggaaactgc agcagccaag tttgagcggc 181 agcacatgga ctccagcact tccgctgcca gcagctccaa ctactgtaac cagatgatga 241 agagccggaa cctgaccaaa gatcgatgca agccagtgaa cacctttgtg cacgagtccc 301 tggctgatgt ccaggccgtg tgctcccaga aaaatgttgc ctgcaagaat gggcagacca 361 attgctacca gagctactcc accatgagca tcaccgactg ccgtgagacc ggcagctcca 421 agtaccccaa ctgtgcctac aagaccaccc aggcgaataa acacatcatt gtggcttgtg 481 agggaaaccc gtacgtgcca gtccactttg atgcttcagt gtaggtctct acctaaggcc 541 agagcagcaa gatgcaccac ttcatcacaa aggcacctgc ctctcccctc atgtttcctt 601 gtcctggggg caatagctca agttagttag ggctcttatc tctgcgcacc ttaccagaaa 661 cacacacaca ggattccctg gcatgaaagc aataactcaa gctagttaag tcttctatcc 721 aacccacact tgctcccctg gcctgagtct tgcccctggt ggtttggggg gtgaggagtg 781 ggttgtgagg tgggacctgt gttaaccaaa tcactgcttc tttcaataaa catacttgca 841 accacctgaa aaaaaaaaaa aaaa // CDS 72..524 /gene="RNASE1" /note="ribonuclease A (pancreatic)" /codon_start=1 /product="ribonuclease" /protein_id="NP_001014408.2" /db_xref="GI:68299789" /db_xref="GeneID:282340" /translation="MALKSLVLLSLLVLVLLLVRVQPSLGKETAAAKFERQHMDSSTS AASSSNYCNQMMKSRNLTKDRCKPVNTFVHESLADVQAVCSQKNVACKNGQTNCYQSY STMSITDCRETGSSKYPNCAYKTTQANKHIIVACEGNPYVPVHFDASV"

  37. El código genético ORIGIN (Ribonucleasa pancreática bovina) 1 ggcagaaact gccttctctc tctcagacat caaactagag acccaggttt ctccagggga 61 gtgcggtcat catggctctgaagtccctgg tcctgttgtc gctgttggtc ctggtgctgc 121 tgctggtgcg ggtccagcct tccctgggca aggaaactgc agcagccaag tttgagcggc 181 agcacatgga ctccagcact tccgctgcca gcagctccaa ctactgtaac cagatgatga 241 agagccggaa cctgaccaaa gatcgatgca agccagtgaa cacctttgtg cacgagtccc 301 tggctgatgt ccaggccgtg tgctcccaga aaaatgttgc ctgcaagaat gggcagacca 361 attgctacca gagctactcc accatgagca tcaccgactg ccgtgagacc ggcagctcca 421 agtaccccaa ctgtgcctac aagaccaccc aggcgaataa acacatcatt gtggcttgtg 481 agggaaaccc gtacgtgcca gtccactttg atgcttcagtgtaggtctct acctaaggcc 541 agagcagcaa gatgcaccac ttcatcacaa aggcacctgc ctctcccctc atgtttcctt 601 gtcctggggg caatagctca agttagttag ggctcttatc tctgcgcacc ttaccagaaa 661 cacacacaca ggattccctg gcatgaaagc aataactcaa gctagttaag tcttctatcc 721 aacccacact tgctcccctg gcctgagtct tgcccctggt ggtttggggg gtgaggagtg 781 ggttgtgagg tgggacctgt gttaaccaaa tcactgcttc tttcaataaa catacttgca 841 accacctgaa aaaaaaaaaa aaaa // CDS 72..524 /gene="RNASE1" /note="ribonuclease A (pancreatic)" /codon_start=1 /product="ribonuclease" /protein_id="NP_001014408.2" /db_xref="GI:68299789" /db_xref="GeneID:282340" /translation="MALKSLVLLSLLVLVLLLVRVQPSLGKETAAAKFERQHMDSSTS AASSSNYCNQMMKSRNLTKDRCKPVNTFVHESLADVQAVCSQKNVACKNGQTNCYQSY STMSITDCRETGSSKYPNCAYKTTQANKHIIVACEGNPYVPVHFDASV"

  38. El código genético • N- ile leu phe arg val ile arg pro ... thr arg asn phe thr ... arg -C • 2 N- tyr phe ile ser ser asn ser thr leu asn ala lys leu his leu thr -C • 1 N- leu phe tyr phe glu ... phe asp leu lys arg glu thr ser leu asn -C pautas de lectura (ORF’s) sentido de lectura para la secuencia de la cadena superior 5’- TTATTTTATTTCGAGTAATTCGACCTTAAACGCGAAACTTCACTTAAC –3’ 3’- AATAAAATAAAGCTCATTAAGCTGGAATTTGCGCTTTGAAGTGAATTG –5’ DNA sentido de lectura para la secuencia de la cadena inferior -1 C- ... lys ile glu leu leu glu val lys phe ala phe ser ... lys val -N -2 C- ile lys asn arg thr ile arg gly ... val arg phe lys val ... arg -N -3 C- asn ... lys ser thr asn ser arg leu arg ser val glu ser leu ser -N pautas de lectura (ORF’s) (ORF’s: Open Reading Frame, pauta abierta de lectura)

  39. El código genético • N- ile leu phe arg val ile arg pro ... thr arg asn phe thr ... arg -C • 2 N- tyr phe ile ser ser asn ser thr leu asn ala lys leu his leu thr -C • 1 N- leu phe tyr phe glu ... phe asp leu lys arg glu thr ser leu asn -C pautas de lectura (ORF’s) sentido de lectura para la secuencia de la cadena superior 5’- TTATTTTATTTCGAGTAATTCGACCTTAAACGCGAAACTTCACTTAAC –3’ 3’- AATAAAATAAAGCTCATTAAGCTGGAATTTGCGCTTTGAAGTGAATTG –5’ DNA sentido de lectura para la secuencia de la cadena inferior -1 C- ... lys ile glu leu leu glu val lys phe ala phe ser ... lys val -N -2 C- ile lys asn arg thr ile arg gly ... val arg phe lys val ... arg -N -3 C- asn ... lys ser thr asn ser arg leu arg ser val glu ser leu ser -N pautas de lectura (ORF’s) (ORF’s: Open Reading Frame, pauta abierta de lectura)

  40. El código genético • N- ile leu phe arg val ile arg pro ... thr arg asn phe thr ... arg -C • 2 N- tyr phe ile ser ser asn ser thr leu asn ala lys leu his leu thr -C • 1 N- leu phe tyr phe glu ... phe asp leu lys arg glu thr ser leu asn -C pautas de lectura (ORF’s) sentido de lectura para la secuencia de la cadena superior 5’- TTATTTTATTTCGAGTAATTCGACCTTAAACGCGAAACTTCACTTAAC –3’ 3’- AATAAAATAAAGCTCATTAAGCTGGAATTTGCGCTTTGAAGTGAATTG –5’ DNA sentido de lectura para la secuencia de la cadena inferior -1 C- ... lys ile glu leu leu glu val lys phe ala phe ser ... lys val -N -2 C- ile lys asn arg thr ile arg gly ... val arg phe lys val ... arg -N -3 C- asn ... lys ser thr asn ser arg leu arg ser val glu ser leu ser -N pautas de lectura (ORF’s) (ORF’s: Open Reading Frame, pauta abierta de lectura)

  41. Mutaciones

  42. Variabilidad genética Las mutaciones son el proceso principal para crear variabilidad genética. Definición: Cambios entre los individuos para un determinado gen o carácter. Si existen diferentes variantes de un mismo gen, se dice que es “polimórfico”, si no hay variabilidad el gen es “monomórfico”.

  43. Variabilidad genética

  44. SNPs • Los SNPs o “polimorfismos de nucleótido único” son variaciones de la secuencia de bases de una región del genoma, que afectan a un único nucleótido. • Para ser considerado un SNP debe ocurrir en al menos un 1% de la población. • Los SNPs proporcionan el 90% de la variación genética humana y ocurren cada 100 o 300 bases a lo largo de todo el genoma (tanto en regiones codificantes como no codificantes). • 2 de cada 3 SNPs corresponden a la sustitución de C por T. • Una gran parte no tienen efecto alguno sobre las funciones celulares, pero algunos pueden producir alteraciones o cambios diversos.

  45. SNPs y Haplotipos • Un determinado número de SNPs en una región concreta, crea un haplotipo (diferentes secuencias que puede tener un fragmento concreto de ADN). • Cada haplotipo contiene SNPs característicos. • Mapa de Haplotipos (Hap Map): mapa de los haplotipos y los SNPs que los caracterizan. • Está permitiendo la identificación de genes y variaciones que afectan a la salud humana.

  46. Haplotipos [ 1 1111111112 2222222223 3333333334 4444444445 5555555556 6666666667 7777777778 ] [ 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 ] #ATcs1 ATTTTTCAGC TATGTACAAT AACAATTGTT GTACCTTGCT AACCCAATGT TATACTACAT CTATGTATAA TATTACATAT #ATcs2 ATTTTTCAGC TATGTACAAT AACAATTGTC GTACCTTGCT AACCCAATGT TATACTACAT CTATGTATAA TATTACATAT #ATcs3 ATTTTTCAGC TATGTACAAT AACAATTGTT GTACCTTGCT AACCCAATAT TATACTACAT CTATGTATAA TATTACATAT #ATcs4 ATTTTTCAGC TATGTACAAT AACAATTGTT GTACCTTGCT AACCCAATGT TATACTACAT CTATGTATAG TATTACATAT [ 1 1111111111 1111111111 1111111111 1111111111 1111111111 1111111111 ] [ 8888888889 9999999990 0000000001 1111111112 2222222223 3333333334 4444444445 5555555556 ] [ 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 ] #ATcs1 TATGTATTTA CCCATATATA TAATATAGCA TG-TGAGTAG TACATCATAT GTATTATCAA CATTAGTGAA TTTAACCCCT #ATcs2 TATGTATTTA CCCATATATA TAATATAGCA TG-TGAGTAG TACATCATAT GTATTATCAA CATTAGTGAA CTTAACCCCT #ATcs3 TATGTATTTA CCCATATATA TAATATAGCA TGATGAGTAG TACATCATAT GTATTATCAA CATTAGTGAA TTTAACCCCT #ATcs4 TATGTATTTA CCCATATATA TAATATAGCA TG-TGAGTAG TACATCATAT GTATTATCAA CATTAGTGAA TTTAACCCCT

  47. Haplotipos [ 1 1111111112 2222222223 3333333334 4444444445 5555555556 6666666667 7777777778 ] [ 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 ] #ATcs1 ATTTTTCAGC TATGTACAAT AACAATTGTT GTACCTTGCT AACCCAATGT TATACTACAT CTATGTATAA TATTACATAT #ATcs2 .......... .......... .........C .......... .......... .......... .......... .......... #ATcs3 .......... .......... .......... .......... ........A. .......... .......... .......... #ATcs4 .......... .......... .......... .......... .......... .......... .........G .......... [ 1 1111111111 1111111111 1111111111 1111111111 1111111111 1111111111 ] [ 8888888889 9999999990 0000000001 1111111112 2222222223 3333333334 4444444445 5555555556 ] [ 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 1234567890 ] #ATcs1 TATGTATTTA CCCATATATA TAATATAGCA TG-TGAGTAG TACATCATAT GTATTATCAA CATTAGTGAA TTTAACCCCT #ATcs2 .......... .......... .......... ..-....... .......... .......... .......... C......... #ATcs3 .......... .......... .......... ..A....... .......... .......... .......... .......... #ATcs4 .......... .......... .......... ..-....... .......... .......... .......... ..........

  48. Haplotipos y variabilidad • La variación de la secuencia de bases en un gen determinado puede cambiar la proteína codificada por ese gen.

  49. Los microsatélites son secuencias de ADN no codificante con motivos repetidos en tándem (entre 1-6 pares de bases) repartidas por todo el genoma Normalmente son marcadores codominantes y neutrales y son utilizados en estudios de genética de poblaciones y en análisis de parentesco Microsatélites

  50. Fallos de la polimerasa (Slipped-strand mispairing) Microsatélites Formación de microsatélites: • Inestabilidad del acoplamiento de las dos cadenas en individuos heterocigotos (mutaciones más frecuentes cuando la diferencia de tamaño entre las cadenas es más elevada)