130 likes | 266 Views
DNA . Deoxyribonucleic Acid. What is dna. DNA is a molecule that determines the traits a person inherits. DNA is described as containing a code. The codes are the rules that are used to carry information. What does DNA look like?.
E N D
DNA Deoxyribonucleic Acid
What is dna • DNA is a molecule that determines the traits a person inherits. • DNA is described as containing a code. • The codes are the rules that are used to carry information.
What does DNA look like? • DNA is the shape of a twisted ladder called a double helix. • The double helix model was introduced by Watson and Click. • The backbone is made of sugars and phosphate groups.
What is DNA made up of? • Dna is made up of Nucleotides. • A base, sugar, and phosphate group make up a nucleotide. • There are 4 bases • (A) adenine • (T) thmine • (C) cytosine • (G) guanine A’s match with T’s and G’s with C’s
White board practice • Make the matching sequence on the white boards. Do not waste my materials by playing around with the markers. • A T G G T C • T A C C A G • G G A C T G A C T • C C T G A C T G A
Replication and mutation • Cells make copies of DNA molecules through a process known as replication. • During replication the two strands of DNA separate two form two new strands of DNA molecules. • When the strands are separated, nucleotides attach to the existing strands to form a new DNA strand.
Mutations • DNA is replicated all the time. It is only expected that there be errors every now and then. • These errors are called mutations. There are three types of mutations • Insertion – when a extra base is added to the strand • Deletion – when a base is left out • Substitution – when a base replaces another type of base. • Mutations can occur by physical or chemical agents called mutagens. • Examples can be UV light and cigarette smoke.
Dna and rna building proteins • To build proteins, DNA copies instructions or code to a molecule called RNA (ribonucleic acid). • RNA has the same sugar and phosphate backbone, but one of the bases change. Instead of having (T) thymine, RNA as (U) Uracil. • The sequencing is the same as DNA but everywhere you would see a T you would now have a U. • A G C C A U G • U C G G U A C
TRANSCRIPTION AND TRANSLATION • Transcription – when the information in DNA is copied to messenger RNA • Only indivdual genes are transcribed not the whole DNA molecule. • Three step process • DNA opens up where the gene is located • RNA bases match up to the complementary bases on the DNA template • Once transcription is complete, mRNA is released and the DNA closes.
Translation • Translation is the process of of making proteins from RNA • Once mRNA is made is goes through an organelle called a ribosome. • As mRNA passes through ribosomes, which is made up of rRNA (ribosomal RNA), tRNA (transfer RNA) molecules deliver amino acids to the ribosome. The amino acids join the RNA to form a protein. • Amino acids are three bases and its sugar and phosphate groups. • ATC GCC TAG CCA - This strand if connected would have 4 amino acids.
coding • White boards • Write the matching sequence. • ATGAATCG • TACTTAGC • How many amino acids are in the following strand • TGCAACGATCGTAGCTTGACG • 7