1 / 13

DNA

DNA . Deoxyribonucleic Acid. What is dna. DNA is a molecule that determines the traits a person inherits. DNA is described as containing a code. The codes are the rules that are used to carry information. What does DNA look like?.

jennifer-bolton
Download Presentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Deoxyribonucleic Acid

  2. What is dna • DNA is a molecule that determines the traits a person inherits. • DNA is described as containing a code. • The codes are the rules that are used to carry information.

  3. What does DNA look like? • DNA is the shape of a twisted ladder called a double helix. • The double helix model was introduced by Watson and Click. • The backbone is made of sugars and phosphate groups.

  4. What is DNA made up of? • Dna is made up of Nucleotides. • A base, sugar, and phosphate group make up a nucleotide. • There are 4 bases • (A) adenine • (T) thmine • (C) cytosine • (G) guanine A’s match with T’s and G’s with C’s

  5. White board practice • Make the matching sequence on the white boards. Do not waste my materials by playing around with the markers. • A T G G T C • T A C C A G • G G A C T G A C T • C C T G A C T G A

  6. Replication and mutation • Cells make copies of DNA molecules through a process known as replication. • During replication the two strands of DNA separate two form two new strands of DNA molecules. • When the strands are separated, nucleotides attach to the existing strands to form a new DNA strand.

  7. Mutations • DNA is replicated all the time. It is only expected that there be errors every now and then. • These errors are called mutations. There are three types of mutations • Insertion – when a extra base is added to the strand • Deletion – when a base is left out • Substitution – when a base replaces another type of base. • Mutations can occur by physical or chemical agents called mutagens. • Examples can be UV light and cigarette smoke.

  8. Dna and rna building proteins • To build proteins, DNA copies instructions or code to a molecule called RNA (ribonucleic acid). • RNA has the same sugar and phosphate backbone, but one of the bases change. Instead of having (T) thymine, RNA as (U) Uracil. • The sequencing is the same as DNA but everywhere you would see a T you would now have a U. • A G C C A U G • U C G G U A C

  9. TRANSCRIPTION AND TRANSLATION • Transcription – when the information in DNA is copied to messenger RNA • Only indivdual genes are transcribed not the whole DNA molecule. • Three step process • DNA opens up where the gene is located • RNA bases match up to the complementary bases on the DNA template • Once transcription is complete, mRNA is released and the DNA closes.

  10. Translation • Translation is the process of of making proteins from RNA • Once mRNA is made is goes through an organelle called a ribosome. • As mRNA passes through ribosomes, which is made up of rRNA (ribosomal RNA), tRNA (transfer RNA) molecules deliver amino acids to the ribosome. The amino acids join the RNA to form a protein. • Amino acids are three bases and its sugar and phosphate groups. • ATC GCC TAG CCA - This strand if connected would have 4 amino acids.

  11. coding • White boards • Write the matching sequence. • ATGAATCG • TACTTAGC • How many amino acids are in the following strand • TGCAACGATCGTAGCTTGACG • 7

More Related