The evolution of lactose tolerance - PowerPoint PPT Presentation

the evolution of lactose tolerance n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
The evolution of lactose tolerance PowerPoint Presentation
Download Presentation
The evolution of lactose tolerance

play fullscreen
1 / 16
The evolution of lactose tolerance
256 Views
Download Presentation
alair
Download Presentation

The evolution of lactose tolerance

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. 09 December 2005 The evolution of lactose tolerance Volvox meeting Sean Myles Max Planck Institute for Evolutionary Anthropology Leipzig, Germany

  2. Lactose Glucose + Galactose Lactase Lactose = complex sugar Lactase = digestive enzyme

  3. Some humans are strange! • All mammals and most humans stop producing • lactase after weaning • Lactose tolerance = lactase persistence • Simple dominant mode of inheritance • Human genetic polymorphism • Where is the mutation?

  4. Genetic association study Step 1: Identify a candidate gene Step 2: Find a mutation in the candidate gene that associates with the trait of interest AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGCTTAGCT Lactose intolerant people AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT Lactose tolerant people

  5. LCT The Lactase Gene MCM6 = exon • C-13910T • 100% association with lactose tolerance • lies in a transcription factor binding site

  6. Lactose tolerance frequencies in the Old World Sweden 99% Germany 80% Greece 47% Japan 15% Bedouin 85% China ~10% Beja 87% Frequency of lactose tolerance Tuareg 87% • 30% 30-60%  60% Tussi 93% Fulani 78% South Africa 5%

  7. Natural Selection “Variations, however slight and from whatever cause proceeding, if they be in any degree profitable to the individuals of a species […] will tend to the preservation of such individuals, and will generally be inherited by the offspring. The offspring, also, will thus have a better chance of surviving, for, of the many individuals of any species which are periodically born, but a small number can survive. I have called this principle, by which each slight variation, if useful, is preserved, by the term natural selection.” (Charles Darwin in The Origin, 1859) Traits that have been driven up in frequency by natural selection are called adaptations.

  8. The culture-historical hypothesis • Simoons (1965) • Cultures that relied on milk as a nutritional • source experienced natural selection for • lactose tolerance • Gene-culture coevolution • Humans co-directed their own biological • evolution by creating the selection pressure • for lactose tolerance

  9. Gene-Culture Coevolution Cultural mediation of selection pressures Cultural mediation of selection pressures Gene pool t Et Culture Development Natural Selection Cultural inheritance Genetic inheritance Time Gene pool Et+1 t + 1 Culture Natural Selection Development

  10. Detecting the signature of selection from genetic data AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTAAGCTTAGGTTAGCT AGCTTGCTATCGGTAAGCTTAGCTTAGCT AGCTTGCTATCGGTATGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT AGCTTGCTATTGGTATGCTTAGCTTAGCT AGCTTGCTATTGGTAAGCTTAGCTTAGCT • SNP = single nucleotide polymorphisms • Occurrence 1 in 1000 nucleotides • Main source of human genetic variation

  11. Genome-wide SNP data • HapMap project • approx. 3 million SNPs in 4 human populations • project will be extended • Perlegen data • approx. 1.5 million SNPs in 3 human populations • Populations include: • African-Americans • European-Americans • Chinese-Americans

  12. = T allele Population A Population B = C allele Pop A = 20% Pop B = 30% Pop A = 20% Pop B = 80% Fst – genetic differentiation • Fst: • a measure of frequency difference between populations Little population differentiation Low Fst Lots of population differentiation High Fst

  13. African-Americans vs. European Americans Fst distribution for 1.5 million SNPs # of SNPs within and around the lactase gene = 100 # of top 1% Fst SNPs within lactase gene = 15 top 1% Fst = 0.5

  14. Evidence for selection? How unusual does the lactase gene look? How often are 15 out of 100 SNPs within the top 1% of the Fst distribution in the whole data set? Sample 10,000 times from data at random blocks of 100 SNPs and count # of top 1% SNPs in each iteration Observed = 15, p = 0.016

  15. What about African dairying populations? . Ga’ali (.53) (0) Wolof (.51) (0) Shaigi (.38) (0) Nuer (.22) (0) Dinka (.26) (0) Evidence for convergent evolution?? Red Frequency of lactose tolerance Blue Expected frequency of lactose tolerance from frequency of -13910T

  16. Lessons from Lactase • Lactose tolerance is rare worldwide and is found at high frequencies only in dairying populations • Genetic signature of selection: the lactase gene in Europeans possesses one of the strongest signatures of selection to be detected in the human genome • Gene-culture coevolution: culture can drive biological evolution in humans • Convergent evolution: lactose tolerance may be an example of recent convergent evolution in humans