Decoding DNA: From Replication to Protein Synthesis
510 likes | 600 Views
Explore the fascinating world of DNA replication and protein synthesis, from Griffith's transformation experiment to Watson and Crick's discovery. Understand DNA structure, replication, transcription, translation, and gene regulation. Dive into animations and quizzes.
Decoding DNA: From Replication to Protein Synthesis
E N D
Presentation Transcript
DNA Structure • Deoxyribonucleic Acid • Double Helix • Made of nucleotides • Pentose Sugar (deoxyribose) • Phosphate • Nitrogenous Base • A-T / C-G
DNA Replication Animation • http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120076/micro04.swf::DNA%20Replication%20Fork
Think About It • If your DNA has 6 billion base pairs and generally there is one mistake made for every 100,000bp that are copied during replication, how many errors should result each time you copied your DNA? • How many errors result in reality? • Why?
RNA Structure • Ribonucleic Acid • Single Strand of nucleotides • Pentose Sugar (ribose) • Phosphate • Nitrogenous Base • A-U / C-G
3 Types of RNA mRNA, tRNA, rRNA
Protein Synthesis • Step 1 – Transcription • Step 2 – Translation
Transcription • Definition • TATA Box • RNA Polymerase • DNA Terminator • 5’ Cap • Poly – A Tail
Transcription Animation • http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__mrna_synthesis__transcription___quiz_2_.html
mRNA Processing http://highered.mcgraw-hill.com/sites/9834092339/student_view0/chapter16/animation_-_exon_shuffling.html
Translation • Definition
mRNA Codons • thedogbitthecatforfun • the dog bit the cat for fun • auguuucgcgggcuaagauaa
Translation Animation • http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter3/animation__how_translation_works.html
Protein Processing • http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter2/animation__protein_denaturation.html
Gene Regulation • Repressible Operon – trp Operon • Inducible Operon – lac Operon