Supplemental FIG. S1 - PowerPoint PPT Presentation

slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Supplemental FIG. S1 PowerPoint Presentation
Download Presentation
Supplemental FIG. S1

play fullscreen
1 / 1
Supplemental FIG. S1
64 Views
Download Presentation
noleta
Download Presentation

Supplemental FIG. S1

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Supplemental FIG. S1 • 1387 CAGUGCUUUAACUCUGUGCA UCACACUUGUCCUUUAAAUG • 1427 GAGACUGUAAGCUUUUAUGA ACUUUUUUUACUUGGACACC • 1467 ACUUUUACACAAAGUAUUUU GAAACAAAAGGCUAUAGGAA • 1507 ACAUGAAAAGGUCAAAUGAU CAUUAUGCUGCUAUGGAGGA • 1547 UGCUACUUGAUGGAGAUCAG CUGCUCGGGGCCAAGAAAAA • 1587 CAGAAUGAGCUACCAUAUUA GGGAGACUGUAGCUGGACUU • 1648 • 1627 CAGAUGAGCUAAUCAAAGUG CAAUUUCUUUUUUAAAGAAU • 1684 1703 • 1667 CUGGCAUGAGUGUUGCCUUU UUAUUUUUAUUUUUUAACUU • 1715 1734 • 1707UAAAAUGAAUGCUGCUACAU AUCUAUCUUUUUUUUUUUUU • 1754 • 1747 UUAAUAAAGAUGCUGUUUAG AAGACAGCUGUUUUUUUU 1784 ARE CPE NPS FIG. S1. The nucleotide sequence of the 3’UTR of the Xenopus laevis cyclin E1 mRNA (Genbank accession Z13966; nt 1387-1784). An ARE present between positions 1684-1703 and a potential CPE at positions 1734-1751 are highlighted by gray boxes. The nuclear polyadenylation sequence (NPS) at position 1749-1754 is indicated by an open box. A stem loop at positions 1692-1715 and a loop at positions 1734-1742 (both underlined) are predicted by mfold analysis of the complete 3’UTR (see Fig. 4); they resemble known binding sites for HuR, the human homolog of ElrA. Numbers above arrows refer to deletion mutants in Fig. 6.