slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part I PowerPoint Presentation
Download Presentation
Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part I

Loading in 2 Seconds...

play fullscreen
1 / 46

Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part I - PowerPoint PPT Presentation


  • 326 Views
  • Uploaded on

Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part I. Jim Bono, PhD Microbiologist US Meat Animal Research Center Clay Center, NE. GPVEC July 31st 2008 Clay Center, NE. Overview of Parts I and II. Part I Biotechnology, GMOs, and Genetic Engineering

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Beef Cattle Production Management Series (2008) Introduction to Biotechnology Part I' - Audrey


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Beef Cattle Production Management Series

(2008)

Introduction to Biotechnology

Part I

Jim Bono, PhD

Microbiologist

US Meat Animal Research Center

Clay Center, NE

GPVEC

July 31st 2008

Clay Center, NE

slide2

Overview of Parts I and II

Part I

Biotechnology, GMOs, and Genetic Engineering

Molecular Genetics (DNA, RNA, and Proteins)

Part II

Applied Molecular Genetics

DNA extraction

Cloning

DNA libraries

Polymerase Chain Reaction (PCR)

DNA sequencing

Single Nucleotide Polymorphism (SNP)

Microarrays

slide3

Biotechnology

Biotechnology is the application of scientific techniques to modify and improve plants, animals, and microorganisms to enhance their value.

Agricultural biotechnology is the area of biotechnology involving applications to agriculture. Agricultural biotechnology has been practiced for a long time, as people have sought to improve agriculturally important organisms by selection and breeding. An example of traditional agricultural biotechnology is the development of disease-resistant wheat varieties by cross-breeding different wheat types until the desired disease resistance was present in a resulting new variety.

http://www.ctahr.hawaii.edu/gmo/intro/

slide4

Genetic Engineering & GMO

In the 1970s, advances in the field of molecular biology provided scientists with the ability to readily transfer DNA — the chemical building blocks that specify the characteristics of living organisms - between more distantly related organisms. Today, this technology has reached a stage where scientists can take one or more specific genes from nearly any organism, including plants, animals, bacteria, or viruses, and introduce those genes into another organism. This technology is sometimes called genetic engineering. An organism that has been modified, or transformed, using modern biotechnology techniques of genetic exchange is referred to as a genetically modified organism (“GMO”).

Roundup herbicide resistance

Insect resistance (Bacillus thuringiensis)

Insulin production

Enviropig(low phosphorus manure - phytate - phytase)

http://www.ctahr.hawaii.edu/gmo/intro/

slide5

Which bull would be the best sire?

Can you tell by their appearance?

slide6

Which bacteria is pathogenic to humans?

Can you tell by their appearance?

pathmicro.med.sc.edu

www.biology.iupui.edu

slide7

“Genetic Playbook”

http://www.kursus.kvl.dk/shares/vetgen/_Popgen/genetics/10/10/sld003.htm

www.petecarroll.com

slide9

Genome

Genome = all genetic material in a cell

Eukaryotes

Prokaryotes

Chromosomes

Chromosome

Plasmid/s

slide11

Deoxyribonucleic acid (DNA)

Nucleotides or bases

Adenine - A

Cytosine - C

Guanine - G

Thymine - T

slide13

Deoxyribonucleic acid (DNA)

Double Helix

Nucleotide or base

Major groove

Minor groove

Phosphate-deoxyribose

backbone

http://en.wikipedia.org/wiki/DNA

slide14

DNA Replication

Spontaneous mutation

Point mutation

Insertion

Deletion

1 error per 1,000 bacterial replication cycles

slide15

L0029

L0028

tir

cesT

eae

Gene

A gene is a locatable region of genomic sequence, corresponding to a unit of inheritance, which is associated with regulatory regions, transcribed regions and/or other functional sequence regions.

A gene is a union of genomic sequences encoding a coherent set of potentially overlapping functional products".

A gene is often used to refer to an inheritable trait which is usually accompanied by a phenotype as in ("tall genes" or "bad genes")

Historically:

“One gene, one Protein”

slide17

Model Gene

Typically, cartoon renderings reflect only the single, “sense”

strand, but realize there is always also a complementary strand.

TATA (-30)

ATG

TAA

AATAA

INTRON

3’

5’

*

*

3’-UT

Promoter

5’-UT

E

I

E

Coding or

Sense strand

EXONS

(Exons contain protein coding sequence, bacterial genes don’t have introns)

* - Transcriptional initiation /termination sites

TATA - Promoter element

TGA, TAA, TAG - Translational stop codon

AATAA - Polyadenylation signal

ATG - Translational start codon

slide18

GGATCGGCTAGCTG……...CTACATAGCTAT

Gene

Transcription

GGAUCGGCUAAGCUAU

mRNA

Translation

Gly-Ser-AlA-…………..

Protein

Protein Biosynthesis

slide19

Transcription

Making a copy of the gene that can be used for translation

Protect the DNA

Uracil (U) instead of Thymine (T)

RNA polymerase reads the nucleotide sequence of the gene and makes a single stranded messenger RNA (mRNA)

http://www.dnai.org/a/index.html

slide20

Translation

Process of making a protein from the mRNA

Changing language from nucleotides to amino acids

Ribosome is responsible for reading the mRNA and making the protein

Translational start – ATG

Translational stop – TAA, TGA, TAG

3 nucleotides are called a codon

Each codon codes for a specific amino acid – 20 amino acids

http://www.dnai.org/a/index.html

slide21

The Genetic Code

DNA

Codon

mRNA

Codon

Encoded Amino Acid

slide22

The Genetic Code

Transfer RNA (tRNA)

Anti-codon

F.W. Nicholas, 1996, Introduction To Veterinary Genetics. Oxford Univ. Press

slide23

Protein

Amino(N)-terminus

Carboxyl(C)-terminus

DNA synthesized 5’-3’

Protein synthesized amino - carboxyl

slide24

Eukaryotic Protein Biosynthesis

TATA (-30)

ATG

TAA

AATAA

5’

3’

*

*

Intron

Promoter

5’-UT

Exon 1

Exon 2

3’-UT

Gene

Transcription

(In nucleus)

*

*

Exon 1---Exon 2

5’-UT

3’-UT

5’

AAAA

3’

mRNA

Translation (@ ribosomes & tRNA)

(In cyctoplasm)

N-terminus

C-terminus

Pre-Protein

* - Transcriptional initiation /termination sites

TATA - Promoter element

TAA, TGA, TAG - Translational stop codon

AATAA - Polyadenylation signal

ATG - Translational start codon

slide25

Homework

Design you own gene

Double stranded DNA

Promoter element

Transcriptional initiation /termination sites

Translational start codon

Intron

Translational stop codon

Polyadenylation signal

slide26

Homework example

Met Pro Ile Gly Asn

tataagaagatctaggaaaggagagattt ATG CCT ATT GGT AAC

atattcttctagatcctttcctctctaaa TAC GGA TAA CCA TTG

Asn Val Leu Gly Stop

cttggtcataatccc AAT GTG CTT GGT TAA gaagatctaata

gaaccagtattaggg TTA CAC GAA CCA ATT cttctagattat

agggatgcatccc

tccctacgtaggg

Legend

tataa – Transcriptional initiation signal

taggaaaggagagattt – 5’ UTR

ATG – Translational start

cttggtcataatccc – intron

TAA – Translational termination

gaagatct – 3’ UTR

aataa – polyadenylation signal

slide27

Beef Cattle Production Management Series

(2008)

Introduction to Biotechnology

Part II

Jim Bono, PhD

Microbiologist

US Meat Animal Research Center

Clay Center, NE

GPVEC

July 31st 2008

Clay Center, NE

slide28

Overview of Parts I and II

Part I

Biotechnology, GMOs, and Genetic Engineering

Molecular Genetics (DNA, RNA, and Proteins)

Part II

Applied Molecular Genetics

DNA extraction

Cloning

DNA libraries

Polymerase Chain Reaction (PCR)

DNA sequencing

Single Nucleotide Polymorphism (SNP)

Microarrays

slide29

DNA extraction

Important to have clean DNA for further experiments

“dirty” prep can have contaminates that inhibit enzymatic processes

Agarose gel electrophoresis

slide30

Cloning

http://student.britannica.com/comptons/art-90884/DNA-sequences-can-be-cut-in-two-ways?&articleTypeId=31

http://www.accessexcellence.org/RC/VL/GG/plasmid.php

slide31

Restriction endonucleases

Enzymes that cuts double-stranded DNA following its specific recognition of short nucleotide sequences, known as restriction sites, in the DNA

slide32

Ligase

An enzyme that can link together two DNA strands that have single-strand breaks, i.e. DNA cut with a restriction endonuclease.

slide33

Cloning

http://student.britannica.com/comptons/art-90884/DNA-sequences-can-be-cut-in-two-ways?&articleTypeId=31

http://www.accessexcellence.org/RC/VL/GG/plasmid.php

slide34

DNA libraries

Genomic library:  Contains entire DNA content

of an organism

Suitable for determining

genomic DNA sequence

Requires chromosomal DNA

isolation

cDNA library:  Contains entire protein-

encoding DNA content

Messenger RNA used as a

starting material

Messenger RNA reverse

transcribed into cDNA

Requires mRNA isolation

slide35

Polymerase Chain Reaction (PCR)

PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications.

DNA cloning for sequencing

DNA-based phylogeny

functional analysis of genes

diagnosis of hereditary diseases

identification of genetic fingerprints (used in

forensic sciences and paternity testing)

detection and diagnosis of infectious diseases.

www.mun.ca/biology/scarr/PCR_sketch_3.gif

slide36

Taq polymerase

Chien A, Edgar DB, Trela JM (1976). "Deoxyribonucleic acid polymerase from the extreme thermophile Thermus aquaticus". J. Bact. 174: 1550–1557

en.wikipedia.org

In 1989 Science Magazine named Taq polymerase its first "Molecule of the Year".

Kary Mullis received the Nobel Prize in 1993, the only one awarded for research performed at a biotechnology company.

http://www.yellowstone.net/geysers/thermalfeatures.htm

slide37

DNA sequencing

The process of determining the exact order of the nucleotides/bases (A, T, C, and G) that make up the DNA of an organism.

Gene number, exact locations, and functions

Gene regulation

DNA sequence organization

Chromosomal structure and organization

Noncoding DNA types, amount, distribution, information content, and functions

Coordination of gene expression, protein synthesis, and post-translational events

Interaction of proteins in complex molecular machines

Predicted vs experimentally determined gene function

Evolutionary conservation among organisms

Protein conservation (structure and function)

Proteomes (total protein content and function) in organisms

Correlation of SNPs (single-base DNA variations among individuals) with health and disease

Disease-susceptibility prediction based on gene sequence variation

Genes involved in complex traits and multigene diseases

Complex systems biology including microbial consortia useful for environmental restoration

Developmental genetics, genomics

slide38

New Sequencing technologies

Roche FLX 454

100 million bases per chip

$6,000

1 week from DNA extraction to sequence data

E. coli genome 5.5 million bases – a 454 run will give an 18x coverage

Human genome 3 billion base – 30 runs would give a 1X coverage

ABI 3730 (384 well plate)

422 thousand bases per plate

9 plates = $6,000

4 million bases

2 weeks from DNA extraction to sequence data

slide39

Single Nucleotide Polymorphism (SNP)

DNA sequence variation occurring when a single nucleotide - A, T, C, or G - in the genome (or other shared sequence) differs between members of a species (or between paired chromosomes in an individual).

Not all SNPs cause a phenotypic change

50K SNP chip – interrogates 50,000 SNP

Parentage

Association of disease traits –FPT

Heaton MP, Harhay GP, Bennett GL, Stone RT, Grosse WM, Casas E, Keele JW, Smith TP, Chitko-McKown CG, Laegreid WW. Selection and use of SNP markers for animal identification and paternity analysis in U.S. beef cattle. Mamm Genome. 2002 May;13(5):272-81.

Clawson ML, Heaton MP, Chitko-McKown CG, Fox JM, Smith TP, Snelling WM, Keele JW, Laegreid WW. Beta-2-microglobulin haplotypes in U.S. beef cattle and association with failure of passive transfer in newborn calves. Mamm Genome. 2004 Mar;15(3):227-36.

slide40

KS368

KS546

TX265

TX723

NE972

NE1370

CO50

TX376

Mass2

EDL 931

1271-84

EDL 933

CO147

CO713

IDPH31277

MARC611

NE1124

TW04863

WRRC1

NE1270

Sakai

TW05356

3526-87

SNPs in E. coli O157:H7

25

20

15

10

35

30

5

0

bovine

100

bovine

0

Ability to predict those isolates which can cause disease in humans

bovine

0

bovine

100

bovine

91

bovine

89

bovine

87

bovine

human

100

human

0

human

0

human

0

bovine

0

bovine

0

78

human

0

bovine

0

bovine

0

bovine

0

human

100

bovine

97

human

94

bovine

95

human

B. Finlay

slide41

…aatggtatcTattaatgctt…

…aatggtatcAattaatgctt…

…aatggtatcAattaatgctt…

SNP

maternal chromosome

maternal chromosome

maternal chromosome

DNA trace files

MALDI-TOF spectra

gene

…aatggtatcTattaatgctt…

…aatggtatcTattaatgctt…

…aatggtatcAattaatgctt…

paternal chromosome

paternal chromosome

paternal chromosome

individual #1:

A

T

Exon 3

Exon 1

Exon 2

Exon 4

A/A

individual #2:

A/T

A/A

T/T

individual #3:

T/T

5100

5400

5700

SNPs

slide42

Many different technologies for SNP interrogation

Real-time PCR

Sequenome

Affymetrix

Illuminia

Biotrove

slide43

DNA Microarrays

A high-throughput technology that consists of an arrayed series of thousands of microscopic spots of DNA oligonucleotides of a specific DNA sequence. This can be a short section of a gene or other DNA element that are used as probes to hybridize DNA or cDNA sample (called target) under high-stringency conditions. Probe-target hybridization is usually detected and quantified by fluorescence-based detection of fluorophore-labeled targets to determine relative abundance of nucleic acid sequences in the target.

slide44

Perfect-

...ATGCATGCATGCATGC...

::::::::::::::::

...TACGTACGTACGTACG*..

Imperfect-

...ATGCATGGGTGCATGC...

::::::: :::::::

...TACGTACGTACGTACG*..

G

Imperfect-

T T

G G

...ATGCATG TGCATGC...

:::::::

:::::::

...TACGTACGTACGTACG*..

Hybridization

Hybridization is the process of combining complementary, single-stranded nucleic acids into a single molecule.

DNA microarrays

mRNA expression SNPs

Gene content

http://www.bio.davidson.edu/Courses/genomics/chip/chip.html

slide45

Homework

Describe PCR in your own words and pictures

Describe a potential application for SNP genotyping in veterinary medicine or beef production

slide46

Websites

http://www.dnai.org/

http://dynamicgene.dnalc.org/structure/structure.html

http://www.blackwellpublishing.com/trun/artwork/Animations/cloningexp/cloningexp.html