tracking the genetic legacy of past human populations through the grid n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Tracking the genetic legacy of past human populations through the grid PowerPoint Presentation
Download Presentation
Tracking the genetic legacy of past human populations through the grid

Loading in 2 Seconds...

play fullscreen
1 / 23

Tracking the genetic legacy of past human populations through the grid - PowerPoint PPT Presentation


  • 91 Views
  • Uploaded on

Tracking the genetic legacy of past human populations through the grid. Nicolas Ray University of Geneva & UNEP/GRID-Europe. Swiss Grid Day, Bern, November 26 th 2009 . Adapted from Cavalli -Sforza & Feldman, 2003. Human migrations. [ 12,000 ]. [55,000]. Homo sapiens sapiens.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Tracking the genetic legacy of past human populations through the grid' - sheila


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
tracking the genetic legacy of past human populations through the grid
Tracking the genetic legacy of past human populationsthrough the grid

Nicolas Ray

University of Geneva & UNEP/GRID-Europe

SwissGrid Day, Bern, November 26th 2009

why aiming at a good demographic model
Why aiming at a good demographic model
  • 1. Better understand human evolution
    • Origin of modern human (when, where, how many?)
    • Relationship with other members of the Homo genus
  • 2. Distinguish between the effect of demography and those of selection (biomedical applications)
slide5

Observed patterns of genetic diversity in contemporary populations

A complex past demography

fluctuation in effective pop. size

substructure

migrations

Gene-specific factors

mutations

recombination

selection

a complex demography

Adapted from Cavalli-Sforza & Feldman, 2003

A complex demography

[10,000]

demographic and spatial expansions

[55,000]

population bottlenecks

secondary contacts

population isolation

fast migration events

splatche
SPLATCHE

SPatiaLAnd Temporal Coalescences in Heterogeneous Environment

(http://cmpg.unibe.ch/software/splatche)

from environment to demography

Carrying

capacity

low

high

From environment to demography

Spatial resolution: 100 km

demographic simulations

Cell or deme

Pop. size

time

Demographic simulations

stepping-stone model (cellular automata)

simulated genealogy

Summary statistics

    • Within population:
      • S, p
    • Between populations
      • PairwiseFST
      • Global FST
    • Globally
      • S, p

ACCTAGTACAATCGGTAATGCCATTGGT

Modèle de mutation

Mutation

Simulated genealogy

TCCTTGTA…ATTGGT

ACCGAGTA…GTTGGT

slide14

ApproximateBayesian Computations (ABC) Computational issues

Computer clusters

1-10 mio.

UBELIX (>500 nodes)

Zooblythii (~40 nodes)

computational issues
Computational issues

A fully spatially-explicit model using 500 loci in 800 individuals:

 10 CPU-years

Adding long-distance dispersal:

 20 CPU-years

splatche on the grid
SPLATCHE on the grid
  • early 2005: joined the Biomed VO of the EGEE project
  • mid 2005: tested on GILDA test bed, and deployed on the Grid
  • since mid 2006: production mode and optimization
use of splatche on the grid

GRID

Statistical tools

Posterior distribution of demographic/genetic parameters of interest

Use of SPLATCHE on the grid

N simulations

  • Independent simulations:
  • the more CPUs, the better
  • job failures are not that bad
optimizations

Submission time

multi-threaded application using up to 30 RBs (used for the WISDOM project)

Fetching time of job outputs

in-house multi-threaded solution for checking status and getting outputs

GRID

Optimizations

Reduction of the number of simulations (Daniel Wegmann)

By MCMC. Promising results (~50 times less sims)

5 mio. simulations

geographic origin of human dispersal
Geographic origin of human dispersal

Ray et al. (2005) GenomeResearch

interactions among populations
Interactions among populations

Interaction between modern humans and Neanderthals in Europe

Currat & Excoffier(2004), PLoS Biol.

cane toad invasion in australia
Cane toad invasion in Australia
  • Estoup, A., Baird, S. J. E., Ray, N., Currat, M., Cornuet, J.-M., Santos, F., Beaumont, M. A. and L. Excoffier. Combining genetic, historical and geographic data to reconstruct the dynamics of the bioinvasion of cane toad Bufomarinus. Submitted