Optimal alignment - PowerPoint PPT Presentation
Introduction to Sequence Alignment
Introduction to Sequence Alignment. Why Align Sequences?. Find homology within the same species Find clues to gene function Practical issues in experiments Find homology in other species Gather info for an evolutionary model Gene families. The Most Visual Way of Aligning Two Sequences.
By Faraday
Similarity Methods
Similarity Methods. C371 Fall 2004. Limitations of Substructure Searching/3D Pharmacophore Searching. Need to know what you are looking for Compound is either there or not Don’t get a feel for the relative ranking of the compounds Output size can be a problem. Similarity Searching.
By issac
Optimal Sum of Pairs Multiple Sequence Alignment
Optimal Sum of Pairs Multiple Sequence Alignment. David Kelley. Dynamic Programming Extension. Standard pairwise sequence alignment methods can be extended to handle k strings. But…. Runtime is O(2 k N k ) k = # of sequences N = average length of sequences Space is O(N k )
By brighton
Inverse Alignment
Inverse Alignment. CS 374 Bahman Bahmani Fall 2006. The Papers To Be Presented. Sequence Comparison - Alignment. Alignments can be thought of as two sequences differing due to mutations happened during the evolution. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC.
By fola
Implementation of Planted Motif Search Algorithms PMS1 and PMS2
Implementation of Planted Motif Search Algorithms PMS1 and PMS2. Clifford Locke BioGrid REU, Summer 2008 Department of Computer Science and Engineering University of Connecticut, Storrs, CT. Introduction. General Problem: Multiple Sequence Comparison Biological Basis DNA structure/function
By boris
Sequence Alignments
Sequence Alignments. Chi-Cheng Lin, Ph.D. Associate Professor Department of Computer Science Winona State University – Rochester Center clin@winona.edu. Sequence Alignments. Cornerstone of bioinformatics What is a sequence? Nucleotide sequence Amino acid sequence
By liona
EX3
EX3. Sequence Alignment: BLAST and Psi-BLAST. Outline. Pairwise alignment : Alignment with gaps Global alignment Local alignment Blast: NCBI BLAST web server NCBI PSI-BLAST web server BLAST through Chimera. Introduction. The Limits of Sequence Similarity. Introduction.
By miette
CSE 182-L2:Blast & variants I Dynamic Programming
CSE 182-L2:Blast & variants I Dynamic Programming. www.cse.ucsd.edu/classes/ fa09/ cse182. www.cse.ucsd.edu/~vbafna. Notes. Assignment 1 is online, due next Tuesday. Discussion section is optional. Use it as a resource.
By molly
Alignment
Alignment. Introduction. Notes courtesy of Funk et al. , SIGGRAPH 2004. Outline: Challenge General Approaches Specific Examples. Translation. Rotation. Scale. Alignment. Challenge : The shape of a model does not change when acted on by similarity transformations:. =. Alignment.
By etoile
Introduction
Introduction. an orthodontic treatment procedure that involves the orderly removal of selected deciduous and permanent teeth in a predetermined sequence { Dewel 1969]. Definition.
By ranit
Sequence Alignments and Dynamic Programming
BIO/CS 471 – Algorithms for Bioinformatics. Sequence Alignments and Dynamic Programming. Module II: Sequence Alignments. Finally a real bioinformatics problem! Problem: SequenceAlignment Input: Two or more strings of characters
By elaine
Sequence Analysis Tools
Sequence Analysis Tools. Erik Arner Omics Science Center, RIKEN Yokohama, Japan arner@gsc.riken.jp. Aim of lecture. Why align sequences? How are sequences aligned to each other? Variants Limitations Basic understanding of common tools for Similarity search Multiple alignment.
By annot
ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES
ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES.
By emery
CS 5263 Bioinformatics
CS 5263 Bioinformatics. Lecture 5: Affine Gap Penalties. Last lecture. Local Sequence Alignment Bounded Dynamic Programming Linear Space Sequence Alignment. The Smith-Waterman algorithm. Initialization : F(0, j) = F(i, 0) = 0 0 F(i – 1, j) – d F(i, j – 1) – d
By sirvat
Exploring Protein Sequences
Tutorial 5. Exploring Protein Sequences. Exploring Protein Sequences. Multiple alignment ClustalW Motif discovery MEME Jaspar. A. C. D. B. Multiple Sequence Alignment. More than two sequences DNA Protein Evolutionary relation Homology Phylogenetic tree Detect motif.
By palma
Kognitio Console Training November 2012
Kognitio Console Training November 2012. November 2012. Using this slide deck. All title slides are hyperlinked for easy navigation simply click on the relevant section/topic you are interested in or view the deck in order for the full course
By ewan
Analyzing Sequences
Analyzing Sequences. Sequences: An Evolutionary Perspective. Evolution occurs through a set of modifications to the DNA These modifications include point mutations, insertions, deletions, and rearrangements
By dieter
Dynamic Programming: BLAST
Doug Raiford Lesson 5. Dynamic Programming: BLAST. Left off…. Recursive alignment solution exponential. Number of sub-problems 3 n This is exponential. And so on. Complexity analysis. Fixed: best Linear: next best Polynomial (n 2 ): not bad Exponential (3 n ): very bad Big O notation
By colman
Applications of Dynamic Programming
Applications of Dynamic Programming. To sequence analysis Shotgun sequence assembly Multiple alignments Dispersed & tandem repeats Bird song alignments Gene Expression time-warping 3D-structure alignment Through HMMs RNA gene search & structure prediction Distant protein homologies
By felice
DNA1: (Last week)
DNA1: (Last week). Types of mutants Mutation, drift, selection Binomial for each Association studies c 2 statistic Linked & causative alleles Alleles, Haplotypes, genotypes Computing the first genome, the second ... New technologies Random and systematic errors.
By guriView Optimal alignment PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Optimal alignment PowerPoint presentations. You can view or download Optimal alignment presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.