'Optimal alignment' presentation slideshows

Optimal alignment - PowerPoint PPT Presentation


Introduction to Sequence Alignment

Introduction to Sequence Alignment

Introduction to Sequence Alignment. Why Align Sequences?. Find homology within the same species Find clues to gene function Practical issues in experiments Find homology in other species Gather info for an evolutionary model Gene families. The Most Visual Way of Aligning Two Sequences.

By Faraday
(281 views)

Similarity Methods

Similarity Methods

Similarity Methods. C371 Fall 2004. Limitations of Substructure Searching/3D Pharmacophore Searching. Need to know what you are looking for Compound is either there or not Don’t get a feel for the relative ranking of the compounds Output size can be a problem. Similarity Searching.

By issac
(356 views)

Optimal Sum of Pairs Multiple Sequence Alignment

Optimal Sum of Pairs Multiple Sequence Alignment

Optimal Sum of Pairs Multiple Sequence Alignment. David Kelley. Dynamic Programming Extension. Standard pairwise sequence alignment methods can be extended to handle k strings. But…. Runtime is O(2 k N k ) k = # of sequences N = average length of sequences Space is O(N k )

By brighton
(216 views)

Inverse Alignment

Inverse Alignment

Inverse Alignment. CS 374 Bahman Bahmani Fall 2006. The Papers To Be Presented. Sequence Comparison - Alignment. Alignments can be thought of as two sequences differing due to mutations happened during the evolution. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC.

By fola
(98 views)

Implementation of Planted Motif Search Algorithms PMS1 and PMS2

Implementation of Planted Motif Search Algorithms PMS1 and PMS2

Implementation of Planted Motif Search Algorithms PMS1 and PMS2. Clifford Locke BioGrid REU, Summer 2008 Department of Computer Science and Engineering University of Connecticut, Storrs, CT. Introduction. General Problem: Multiple Sequence Comparison Biological Basis DNA structure/function

By boris
(65 views)

Sequence Alignments

Sequence Alignments

Sequence Alignments. Chi-Cheng Lin, Ph.D. Associate Professor Department of Computer Science Winona State University – Rochester Center clin@winona.edu. Sequence Alignments. Cornerstone of bioinformatics What is a sequence? Nucleotide sequence Amino acid sequence

By liona
(221 views)

EX3

EX3

EX3. Sequence Alignment: BLAST and Psi-BLAST. Outline. Pairwise alignment : Alignment with gaps Global alignment Local alignment Blast: NCBI BLAST web server NCBI PSI-BLAST web server BLAST through Chimera. Introduction. The Limits of Sequence Similarity. Introduction.

By miette
(167 views)

CSE 182-L2:Blast & variants I Dynamic Programming

CSE 182-L2:Blast & variants I Dynamic Programming

CSE 182-L2:Blast & variants I Dynamic Programming. www.cse.ucsd.edu/classes/ fa09/ cse182. www.cse.ucsd.edu/~vbafna. Notes. Assignment 1 is online, due next Tuesday. Discussion section is optional. Use it as a resource.

By molly
(90 views)

Alignment

Alignment

Alignment. Introduction. Notes courtesy of Funk et al. , SIGGRAPH 2004. Outline: Challenge General Approaches Specific Examples. Translation. Rotation. Scale. Alignment. Challenge : The shape of a model does not change when acted on by similarity transformations:. =. Alignment.

By etoile
(160 views)

Introduction

Introduction

Introduction. an orthodontic treatment procedure that involves the orderly removal of selected deciduous and permanent teeth in a predetermined sequence { Dewel 1969]. Definition.

By ranit
(115 views)

Sequence Alignments and Dynamic Programming

Sequence Alignments and Dynamic Programming

BIO/CS 471 – Algorithms for Bioinformatics. Sequence Alignments and Dynamic Programming. Module II: Sequence Alignments. Finally a real bioinformatics problem! Problem: SequenceAlignment Input: Two or more strings of characters

By elaine
(142 views)

Sequence Analysis Tools

Sequence Analysis Tools

Sequence Analysis Tools. Erik Arner Omics Science Center, RIKEN Yokohama, Japan arner@gsc.riken.jp. Aim of lecture. Why align sequences? How are sequences aligned to each other? Variants Limitations Basic understanding of common tools for Similarity search Multiple alignment.

By annot
(116 views)

ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES

ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES

ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES.

By emery
(132 views)

CS 5263 Bioinformatics

CS 5263 Bioinformatics

CS 5263 Bioinformatics. Lecture 5: Affine Gap Penalties. Last lecture. Local Sequence Alignment Bounded Dynamic Programming Linear Space Sequence Alignment. The Smith-Waterman algorithm. Initialization : F(0, j) = F(i, 0) = 0 0 F(i – 1, j) – d F(i, j – 1) – d

By sirvat
(115 views)

Exploring Protein Sequences

Exploring Protein Sequences

Tutorial 5. Exploring Protein Sequences. Exploring Protein Sequences. Multiple alignment ClustalW Motif discovery MEME Jaspar. A. C. D. B. Multiple Sequence Alignment. More than two sequences DNA Protein Evolutionary relation Homology  Phylogenetic tree Detect motif.

By palma
(151 views)

Kognitio Console Training November 2012

Kognitio Console Training November 2012

Kognitio Console Training November 2012. November 2012. Using this slide deck. All title slides are hyperlinked for easy navigation simply click on the relevant section/topic you are interested in or view the deck in order for the full course

By ewan
(326 views)

Analyzing Sequences

Analyzing Sequences

Analyzing Sequences. Sequences: An Evolutionary Perspective. Evolution occurs through a set of modifications to the DNA These modifications include point mutations, insertions, deletions, and rearrangements

By dieter
(133 views)

Dynamic Programming: BLAST

Dynamic Programming: BLAST

Doug Raiford Lesson 5. Dynamic Programming: BLAST. Left off…. Recursive alignment solution exponential. Number of sub-problems 3 n This is exponential. And so on. Complexity analysis. Fixed: best Linear: next best Polynomial (n 2 ): not bad Exponential (3 n ): very bad Big O notation

By colman
(133 views)

Applications of Dynamic Programming

Applications of Dynamic Programming

Applications of Dynamic Programming. To sequence analysis Shotgun sequence assembly Multiple alignments Dispersed & tandem repeats Bird song alignments Gene Expression time-warping 3D-structure alignment Through HMMs RNA gene search & structure prediction Distant protein homologies

By felice
(185 views)

DNA1: (Last week)

DNA1: (Last week)

DNA1: (Last week). Types of mutants Mutation, drift, selection Binomial for each Association studies c 2 statistic Linked & causative alleles Alleles, Haplotypes, genotypes Computing the first genome, the second ... New technologies Random and systematic errors.

By guri
(75 views)

View Optimal alignment PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Optimal alignment PowerPoint presentations. You can view or download Optimal alignment presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.