nucleic acid structure and function n.
Download
Skip this Video
Download Presentation
Nucleic Acid Structure and Function

Loading in 2 Seconds...

play fullscreen
1 / 36

Nucleic Acid Structure and Function - PowerPoint PPT Presentation


  • 82 Views
  • Uploaded on

Nucleic Acid Structure and Function. Structures of DNA and RNA Duplication of DNA Production of RNA and Protein. replication (S phase). transcription. translation. Information Flow From DNA. Gene: sequence of DNA that codes for a protein. DNA. (G1 and G2 phases). RNA. Protein.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Nucleic Acid Structure and Function' - mia-schultz


Download Now An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
nucleic acid structure and function

Nucleic Acid Structure and Function

Structures of DNA and RNA Duplication of DNA Production of RNA and Protein

slide2

replication

(S phase)

transcription

translation

Information Flow From DNA

Gene: sequence of DNA that codes for a protein

DNA

(G1 and G2

phases)

RNA

Protein

dna and rna structure

base

phosphate

DNA and RNA Structure

Nucleotide = phosphate + sugar + nitrogen-containing base

three parts of nucleotide structure

NH2

C

N

C

N

HC

OH

CH2

CH

C

N

N

O

O

HO

P

DeoxyriboseorRibose

H

H

O

H

H

OH

H

Three Parts of Nucleotide Structure

Phosphate Group

NitrogenousBase (1 of 5)

5-Carbon Sugar

nucleotide chain
Nucleotide Chain

Nucleotides are joined together by dehydration synthesis

The phosphate of one nucleotide is joined to sugar of next nucleotide, forming a “sugar-phosphate backbone”

dna structure

T

G

T

A

C

T

3’ end

DNA Structure

A

5’ endhas free phosphate

  • Two polynucleotide chains
  • In opposite orientations
  • Held together by hydrogen bonds
  • Twisted into a helix

C

G pairs with C

A

T

G

A

3’ endhas free sugar

5’ end

A pairs with T

slide11

A

T

C

G

applying your knowledge
Applying Your Knowledge

In the DNA double helix, which base is paired with adenine?

  • Adenine
  • Cytosine
  • Guanine
  • Thymine
  • Uracil
dna replication1
DNA Replication

DNA replication is semiconservative.

Each strand is used as a template to produce a new strand.

AGCTAGCTAGCT

 AGCTAGCTAGCT old

AGCTAGCTAGCTTCGATCGATCGA

TCGATCGATCGA new

AGCTAGCTAGCT new

TCGATCGATCGA

 TCGATCGATCGA old

dna replication2
DNA Replication

DNA replication requires

1. Enzymes, including DNA polymerase that adds nucleotides in a 5’3’ direction.

2. nucleotides

3. energy

5’—A G C T — 3’

3’— T

C

G

A — 5’

5’— A

G

C

T— 3’

3’—T C G A — 5’

applying your knowledge1
After DNA replication, what is the composition of the new double-helical molecules?

Two new chains

Two old chains

One old and one new chain

One helix has two new chains and one has two old chains

None of these is correct.

Applying Your Knowledge
transcription production of rna using dna as a template
Transcription = Production of RNA Using DNA as a Template
  • DNA chains separate
  • ONE DNA chain is used as a pattern to produce an RNA chain
  • RNA chain is released and the DNA chains reform the double-helix

In DNA In RNAA U

T A

G C

C G

transcription

3’---TACAAA GAGACT---5’ DNA template

5’---ATG TTTCTC TGA---3’

Transcription

Transcription requires

1. Enzymes, including RNA polymerase that adds nucleotides in a 5’3’ direction.

2. nucleotides

3. energy

3’---TACAAAGAGACT---5’

5’---ATG TTTCTC TGA---3’

5’---AUGUUUCUCUGA---3’ mRNA

applying your knowledge2
Applying Your Knowledge

What is the sequence of an RNA molecule transcribed from a DNA template strand that reads 3’-ATG-5’?

  • 5’-TAC-3’
  • 5’-CAU-3’
  • 5’-AUG-3’
  • 5’-UAC-3’
  • 3’-TAC-5’
products of transcription
Products of Transcription
  • Messenger RNA

Contains the code words for the sequence of amino acids in a specific protein

CODON = group of three nucleotides acting as a code word for an amino acid

products of transcription1

In mRNA In tRNAA U

U A

G C

C G

mRNA

Products of Transcription
  • Transfer RNA

“Translates” the message by bringing a specific amino acid into the correct position on the growing protein chain

Has ANTICODON = a group of three nucleotides on a tRNA that recognizes a mRNA codon

Has amino acid attachment site

genetic code
Genetic Code

Chart is written as a CODON dictionary, reading 5’3’

products of transcription2

for tRNA

for tRNA

small ribosomal subunit

mRNA binding site

Products of Transcription
  • Ribosomal RNA

One of the structural components of the ribosome

Ribosome = organelle where protein synthesis occurs

Has sites to bind both mRNA and tRNA

applying your knowledge3
Applying Your Knowledge

Which molecule contains the information for assembling the amino acids in the correct order in the protein?

  • rRNA
  • tRNA
  • mRNA
  • All of these
  • None of these
translation
Translation

At the ribosome, codons in mRNA are recognized by tRNA anticodons to place amino acids in the specific sequence specified by the DNA.

Three Stages of Translation:

Initiation- assemble components to start process

Elongation- add amino acids in repeated cycles

Termination- release protein product

translation1
Translation

Initiation

mRNA binds to ribosome

First tRNA binds to mRNA

met

UAC

5’---AUGUUUCUCUGA---3’ mRNA

translation2
Translation

Elongation

Next tRNA binds to mRNA

met

phe

UAC

AAA

5’---AUGUUUCUCUGA---3’ mRNA

translation3
Translation

Elongation

Amino acids are joined

First tRNA is released

met

phe

UAC

AAA

5’---AUGUUUCUCUGA---3’ mRNA

translation4
Translation

Elongation

Ribosome moves by one codon

met

phe

UAC

AAA

5’---AUGUUUCUCUGA---3’ mRNA

translation5
Translation

Elongation (second cycle)

Next tRNA binds to mRNA

met

phe

leu

UAC

AAA

GAG

5’---AUGUUUCUCUGA---3’ mRNA

translation6
Translation

Elongation (second cycle)

Amino acids are joined

Second tRNA is released

met

phe

leu

UAC

GAG

5’---AUGUUUCUCUGA---3’ mRNA

AAA

translation7
Translation

Elongation (second cycle)

Ribosome moves by one codon

met

phe

leu

UAC

GAG

5’---AUGUUUCUCUGA---3’ mRNA

AAA

translation8
Translation

Termination

Termination factor binds to stop codon

met

phe

leu

UAC

T

GAG

5’---AUGUUUCUCUGA---3’ mRNA

AAA

translation9
Translation

Termination

Protein chain is released

Other components separate

met

phe

leu

UAC

T

GAG

AAA

5’---AUGUUUCUCUGA---3’ mRNA

applying your knowledge4
Applying Your Knowledge

If the mRNA sequence for codons 5, 6, and 7 of a protein is 5’-AAG-AUU-GGA-3’, what is the amino acid sequence in the protein?

  • Gly-ile-lys
  • Arg-leu-glu
  • Glu-leu-arg
  • Asn-met-gly
  • Lys-ile-gly