Review & study day

1. Review & study day Friday, May 9, 2014

2. Objective foci(volunteer to read) Describe how radioactive probes are used in DNA fingerprinting Explain how DNA fingerprinting is used to determine if specimens come from related or unrelated individuals Explain how to use DNA fingerprinting to identify DNA from a parent, child, or relative of another person

3. Rules(two volunteers to read) Questions will rotate around the room (counter-clockwise… Asia G  Cameron  DeAsia  Asiah W  Ca’Juan  Cortez  Asia G again Teams have 1 minute (60 seconds) to answer the question If a team answers a questions incorrectly, it goes to the next team If a team speaks out while it is another team’s turn, they lose their turn If a team answers a question correctly, they have a chance to try the next No notes, articles, or electronics allowed. Only blank paper and writing utensils allowed to take notes on things you need to study If teams cheat (using notes, electronics, etc.), they lose three points the first time and lose the game entirely the second time QUESTIONS?

4. Deciding Who Goes first On a half-sheet of paper, write your best answer to this question: Why do forensic scientists call this type of evidence DNA fingerprinting? You have one minute ONLY to write your answer and hand it to Mr. Valasek, so he can pick the best answer to go first. Ties broken by best out of three of rock-paper-scissors

5. Electrophoresis Expulsion Amplification Restriction Fragments Question 1 Pick the step that does not belong in the following list of how to DNA fingerprint

6. Electrophoresis Extraction Amplification Restriction Fragments Question 2 Put the steps in the following list of how to DNA fingerprint in their correct order

7. Extraction Restriction Fragments Amplification Electrophoresis Question 2 Pick the step in the following list that means making enough DNA for DNA fingerprinting

8. Extraction Restriction Fragments Amplification Electrophoresis Question 3 Pick the step in the following list that means isolating the DNA from the rest of the biological material

9. Extraction Restriction Fragments Amplification Electrophoresis Question 4 Describe why electrophoresis would be ineffective without restriction fragments Restriction fragments are the “sliced-up” pieces of DNA that show the VNTRs & STRs, so that DNA can be used as individualized evidence… Electrophoresis would simply show one big dot if no restriction fragments were cut

10. Agarose Gel Separating DNA fragments Question 5 For the following question, explain how the next two ideas are related Electrophoresis separates the DNA fragments in agarose gel, because of its internal matrix (or criss-crossingfiberous structure)

11. Negatively-charged drop well Positively-charged electrode Question 6 For the following question, explain how the next two ideas are related Within the agarose gel, the DNA fragments are dropped into the negatively-charged well and migrate toward the positively-charged electrode when the electric current begins

12. Probes Digital Imaging Genes Question 7 If geneticists decide not to amplify their sample, what must they use instead to see the results?

13. 20,000 base pairs 10,000 base pairs 5,000 base pairs 15,000 base pairs Question 8 Place the following fragments in order as they would appear in gel electrophoresis

14. Protein and a gene Base pairs and a radioactive compound Alleles and a chromosome Question 9 DNA Probes are composed of two parts:

15. TTCGAAT • TTCGAAT • AAGCUUA • AAGCTTA • TAAGCTT Question 10 The following probe would highlight which DNA fragment:

16. agcttgcaacgtaatcccgtaactattattattattattattatgcgaaggaggagggaggcgtatggagggtttcttaacgtattatctagcttgcaacgtaatcccgtaactattattattattattattatgcgaaggaggagggaggcgtatggagggtttcttaacgtattatct Question 11 Find the portion of this sequence a geneticist would want to highlight with a DNA probe

17. Digital image Autoradiograph X-ray Double-helix Question 12 When a geneticist decides to develop a film image of the electrophoresis, they call this:

18. Greater, lesser Lesser, greater Greater, greater Question 13 Fill in the blanks. “The _____ the number of probes used on a DNA fingerprint, the _____ the accuracy of the DNA fingerprint”

19. B. How many do they receive from each parent? 2, 1, or ½ Question 14 A. Children receive how many genes of each trait? 2, 1, or 4

20. Crime-scene DNA matching with suspect’s DNA Discovery of dinosaur remains Paternity and maternity determination Identify family members and relatives Suspect elimination Finding good candidates for space flight Freeing those who have been falsely accused Identification of human remains Question 15 Find all the wrong uses of DNA fingerprinting from this list

21. Who’s whose Daddy? Follow these steps to find the father of each child.

22. Who’s the criminal? Follow the steps from Wednesday (from memory) to find the criminal out of the three suspects