300 likes | 1.49k Views
GEL ELECTROPHORESIS. Gel electrophoresis is a process used by scientists to separate mixtures of molecules by size, creating a DNA “fingerprint” It is most often used to separate molecules of proteins and molecules of DNA. Everyone has their own unique DNA (unless you have an identical twin)
E N D
Gel electrophoresis is a process used by scientists to separate mixtures of molecules by size, creating a DNA “fingerprint” • It is most often used to separate molecules of proteins and molecules of DNA
Everyone has their own unique DNA (unless you have an identical twin) This is what makes it very useful as evidence for solving crimes. DNA GEL ELECTROPHORESIS
DNA gel electrophoresis produces a banding pattern that looks like a bar code, which is unique to each person. This is the DNA fingerprint or profile.
Prove guilt by matching DNA found at a crime scene to a suspect Exonerate an innocent person Paternity testing Identification of John or Jane Does . Uses of DNA Profiles
Determine current and evolutionary relationships among living things Determine and identify the genes responsible for certain inherited disorders Uses of DNA fingerprinting
The Process of Electrophoresis • Special enzymes called restriction enzymes are used to cut DNA in specific places (biological scissors)
XBAM111 IS AN RESTRICTION ENZYME THAT CUTS BETWEEN GGCC • ATGGCCTAAAAGGCCATGGCCAGGCCAC • ATGG/CCTAAAAGG/CCATGG/CCAGG/CCAC
This produces DNA fragments of different lengths • ATGG/CCTAAAAGG/CCATGG/CCAGG/CCAC • ATGG • CCTAAAGG • CCATGG • CCAGG • CCAC • These pieces of DNA will be different in each person due to their unique genetic code
Process of Electrophoresis • The DNA samples are loaded into wells in a gel that is located in a gel box
The gel box has 2 electrodes, one positive and one negative and is attached to a power source
Since DNA has a negative charge it will move toward the positive electrode
The size of a DNA fragment depends on how many base pairs it contains • ATGG • CCTAAAGG • CCATGG • CCAGGCC
The smaller base pairs move faster and farther through the gel
The distinct pattern or “fingerprint” that is made becomes visible to the human eye by staining and/ or using ultraviolet light
The DNA patterns are now compared for similarities and differences