1 / 17

Chapter 17.

Chapter 17. RNA Processing. Transcription -- another look. The process of transcription includes many points of control when to start reading DNA where to start reading DNA where to stop reading DNA editing the mRNA protecting mRNA as it travels through cell. Primary transcript.

chavez
Download Presentation

Chapter 17.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Chapter 17. RNA Processing

  2. Transcription -- another look • The process of transcription includes many points of control • when to start reading DNA • where to start reading DNA • where to stop reading DNA • editing the mRNA • protecting mRNA as it travels through cell

  3. Primary transcript • Processing mRNA • protecting RNA from RNase in cytoplasm • add 5’ cap • add polyA tail • remove introns AUG UGA

  4. Protecting RNA • 5’ cap added • G trinucleoside (G-P-P-P) • protects mRNA • from RNase (hydrolytic enzymes) • 3’ poly-A tail added • 50-250 A’s • protects mRNA • from RNase (hydrolytic enzymes) • helps export of RNA from nucleus UTR UTR

  5. “AVERAGE”… “gene” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa “JUNK”! Dicing & splicing mRNA • Pre-mRNA  mRNA • edit out introns • intervening sequences • splice together exons • expressed sequences • In higher eukaryotes • 90% or more of gene can be intron • no one knows why…yet • there’s a Nobel prize waiting…

  6. 1977 | 1993 Discovery of Split genes Richard Roberts Philip Sharp adenovirus NE BioLabs MIT common cold Discovered that the sequence of DNA Nucleotides that code for a polypeptide is usually split into segments (introns & exons)

  7. Splicing enzymes • snRNPs • small nuclear RNA • RNA + proteins • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste • RNA as ribozyme • some mRNA can splice itself • RNA as enzyme

  8. 1982 | 1989 Ribozyme • RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado

  9. Splicing details • No room for mistakes! (Mistakes – Mutation) • editing & splicing must be exactly accurate • a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  10. Universal code • 3 bases on mRNA are called Codons. • Each codon specifies and amino acid. • AUG is a start codon • 3 stop codons • Code is redundant • several codons for each amino acid *What’s the value in redundancy in the genetic code?

  11. Hard to definea gene! Alternative splicing • Alternative mRNAs produced from same gene • when is an intron not an intron… • different segments treated as exons

  12. Value of Alternative splicing? • Allows a small number of genes to make many different proteins.

  13. Domains (Gene can include many exons!) • Modular architectureof many proteins • separate functional & structural regions • coded by different exons in same “gene”

  14. enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA UTR UTR introns promoter transcription start transcription stop pre-mRNA 5' 3' 5' 3' mature mRNA The Transcriptional unit (a gene +) transcriptional unit 3' 5' TAC ACT TATA DNA GTP AAAAAAAA

  15. cDNA (Complementary DNA) • http://highered.mcgraw-hill.com/olc/dl/120078/bio_h.swf

  16. Any Questions??

  17. enhancer 1000+b 20-30b RNA polymerase 5' 3' 5' 3' The Transcriptional unit exons transcriptional unit 3' 5' TAC ACT TATA DNA introns

More Related