1 / 16

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction. Dynamic Programming Approaches Sarah Aerni. http://www.tbi.univie.ac.at/. RNA folding Dynamic programming for RNA secondary structure prediction. Outline. RNA Basics. RNA bases A,C,G,U Canonical Base Pairs A-U G-C

adriennes
Download Presentation

RNA Secondary Structure Prediction

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. RNA Secondary Structure Prediction Dynamic Programming Approaches Sarah Aerni http://www.tbi.univie.ac.at/

  2. RNA folding Dynamic programming for RNA secondary structure prediction Outline

  3. RNA Basics • RNA bases A,C,G,U • Canonical Base Pairs • A-U • G-C • Bases can only pair with one other base. Image: http://www.bioalgorithms.info/

  4. Basics of RNA Structure

  5. RNA Secondary Structure Pseudoknot Stem Interior Loop Single-Stranded Bulge Loop Junction (Multiloop) Hairpin loop Image– Wuchty

  6. Nesting

  7. Circle Plot • Linear RNA strand folded back on itself to create secondary structure • Circularized representation uses this requirement • Arcs represent base pairing Images – David Mount • All loops must have at least 3 bases in them • Equivalent to having 3 base pairs between all arcs Exception: Location where the beginning and end of RNA come together in circularized representation

  8. Pseudoknots

  9. Trouble with Pseudoknots • Pseudoknots cause a breakdown in the Dynamic Programming Algorithm. • In order to form a pseudoknot, checks must be made to ensure base is not already paired – this breaks down the recurrence relations Images – David Mount

  10. Base Pair Maximization A C C A Problem: Find the RNA structure with the maximum (weighted) number of nested pairings G C C G G C A U A U U A U A C A G A C A C A G U A A G C U C G C U G U G A C U G C U G A G C U G G A G G C G A G C G A U G C A U C A A U U G A ACCACGCUUAAGACACCUAGCUUGUGUCCUGGAGGUCUAUAAGUCAGACCGCGAGAGGGAAGACUCGUAUAAGCG

  11. Base Pair Maximization – Dynamic Programming Algorithm S(i,j) is the folding of the subsequence of the RNA strand from index i to index j which results in the highest number of base pairs Simple Example: Maximizing Base Pairing Unmatched at i Bifurcation Umatched at j Base pair at i and j Images – Sean Eddy

  12. Base Pair Maximization – Dynamic Programming Algorithm S(i, j – 1) • Alignment Method • Align RNA strand to itself • Score increases for feasible base pairs • Each score independent of overall structure • Bifurcation adds extra dimension S(i + 1, j) Initialize first two diagonal arrays to 0 Fill in squares sweeping diagonally Bases cannot pair, similar to unmatched alignment Bases can pair, similar to matched alignment Dynamic Programming – possible paths S(i + 1, j – 1) +1 Images – Sean Eddy

  13. Base Pair Maximization – Dynamic Programming Algorithm • Alignment Method • Align RNA strand to itself • Score increases for feasible base pairs • Each score independent of overall structure • Bifurcation adds extra dimension Reminder: For all k S(i,k) + S(k + 1, j) Reminder: For all k S(i,k) + S(k + 1, j) k = 0 : Bifurcation max in this case S(i,k) + S(k + 1, j) Initialize first two diagonal arrays to 0 Fill in squares sweeping diagonally Bases cannot pair, similar Bases can pair, similar to matched alignment Dynamic Programming – possible paths Bifurcation – add values for all k Images – Sean Eddy

  14. Example

  15. Base Pair Maximization - Drawbacks • Base pair maximization will not necessarily lead to the most stable structure • May create structure with many interior loops or hairpins which are energetically unfavorable • Not biologically reasonable

  16. References • How Do RNA Folding Algorithms Work?. S.R. Eddy. Nature Biotechnology, 22:1457-1458, 2004.

More Related