Conclusions about variation

1. Conclusions about variation • A species is not genetically uniform over its geographic range • Some differences appear to be adaptive consequences • Genetic differences between populations are the same in kind as genetic differences among individuals within a pop.

2. Origin of Genetic Variation (chapt 10) • Gene mutation – an alteration of the genetic (DNA) sequence • Mutations have evolutionary consequences only if they are transmitted to the next generation • Somatic cell • Germ line cell

3. Various types of mutations • Point mutations • Transition – substitution of a purine for a purine or a pyrimidine for pyrimidine (A G) or (C T) • Transversion – substitution of a purine for a pyrimidine or vice-versa (A T) or (A C) ... and so-on

4. Categories of Point Mutations • Synonymous • Change in DNA sequence  No Change in Amino Acid sequence • Non-Synonymous • Change in DNA sequence  Change in Amino Acid sequence

5. Second base U C A G UUU Phenyl- alanine UCU UAU UGU U U C A G Tyrosine Cysteine UUC UCC UAC UGC Serine UCA Stop codon UUA Stop codon UAA UGA Leucine UCG UUG Tryptophan UAG UGG Stop codon CGU CCU CUU CAU U C A G C Histidine CGC CCC CAC CUC Leucine Proline Arginine CGA CCA CUA CAA Glutamine First base CUG CGG CCG CAG Third base AUU AGU U C A G ACU AAU Serine Asparagine AUC AGC Isoleucine ACC A AAC Theronine AUA ACA AGA AAA ACG Lysine Arginine Methionine start codon AUG AGG AAG GGU Aspartic acid GUU GCU U C A G GAU GGC G GUC GCC GAC Valine Alanine Glycine GGA GUA GCA GAA Glutamic acid GGG GUG GCG GAG

6. Synonymous VS. Nonsynonymous DNA1 = AAA GCT CAT GTA GAA DNA2 = AAT GCT GAT GTA GAA Protein1 = Lys Ala His Val Glu Protein2 = Lys Ala Asp Val Glu Synonymous mutation Nonsynonymous mutation

7. Various types of mutations • Frameshift Mutations • Where nucleotides in the DNA sequence are added or deleted, creating a change in the reading frame for the protein encoded by the gene

8. Frameshift Mutations

9. Transposable elements • Sequences that can move to any of the many places in the genome • Barbara McClintock Maize 1950’s

10. Transposable elements • Carry genes that code for transposases. • Carryout transposition • Conservative transposition • Replicative transposition • Process of insertion generates 4-12bp repeats of the host DNA at the end of the element.

11. Transposable elements • Insertion sequences: 700-2600bp only code for transposases • Transposons: 500-7000bp encode transposases + other functional genes. • Retroelements: use reverse transcriptase to transcribe. HIV like. Except they do not cross cell boundaries and spread only by cell division

12. Effects on host genome • Increase total genome size • Alteration of host gene expression • Increase in mutation rate of host genes • Chromosome rearrangements (host) • Retrogenes. Reverse transcription • Most non functional • psuedogenes

13. Mutation Rates • Estimates of u (mutation) depends on how you calculate them • Phenotypic studies • White vs red eye in Drosophila • DNA sequence studies • Count number between 2 closely related organisms

14. Mutation estimates • Usually count the number of mutations, scored by their phenotypic effects among the offspring of an initially homozygous stock. • In Drosophila and other multi-cell organisms usually measure # of chromosomes bearing a particular mutation from a homozygous population for an allele. Use special crosses to visualize phenotypic effect.

15. Mutation estimates • The autosomal chromosomes of N flies represents 2N gametes that form them, so mutation rate is calculated the number of new mutations per gamete per generation • Avg. locus mutation rate based on phenotypic effects 10-6 - 10-5 mutations per gamete per generation

16. Mutation Rates • Back mutations: mutation of an allele from the mutant type back to “wild type” • Multiple hits: multiple substitutions at same site.

17. Estimating Substitution rate from DNA sequence Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....C......T.................. Taxon 2) .....G......T........C......... Taxon 3) .....C...........A............. Taxon 4) .....G...........A........G.... Average mutation rate per base pair has been estimated at 10-9

18.  Purines     Pyrimidines  A G C T

19. Substitutions Time 0 Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....C......T.................. Taxon 2) .....G......T........C......... Taxon 3) .....C...........A............. Taxon 4) .....G...........A........G....

20. Substitutions Time 1 Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....A......T.................. Taxon 2) .....G......G........C......... Taxon 3) .....G...........A............. Taxon 4) .....G...........A........G....

21. Substitutions Time 2 Outgroup) ATGTCAGGGACTCAGATCGAATGGGATCTAG Taxon 1) .....G......T.................. Taxon 2) .....G......T........C......... Taxon 3) .....G...........A............. Taxon 4) .....G...........A........G.... Multiple Substitutions at the same site

22. Evolutionary implications of Mutation rates • Avg. per-locus mutation rate of 10-5 (1 in 100,000 generations) is so low that the rate of change in the frequency of an allele, due to mutation alone, is very low. • Phenotypically distinguishable alleles A1 and A2

23. Evolutionary implications of Mutation rates • These have allele freq. p(=1-q) and q. • A1 mutates to A2 at rate u= 10-5 • Therefore in each generation, the frequency of A2 is increased by u x p (that is, a fraction u of A1 alleles mutate. • Thus change in freq of A2 ∆q = up=u(1-q)

24. Mutation rates • q = 0.5 • In the following generation • q’ = q + ∆q = • ∆q = up = 10-5 (0.5) = 0.000005 • 0.5 + 0.000005 = 0.5000005

25. Mutation rates • How does mutation affect the freq. of alleles on a pop. • assume no back mutation pt = poe-ut qt = 1-poe-ut u = forward mutation t = # of generations q = .5 change q = .75 = 70,000 generations q = .75 change q = .875 = 70,000 generations

26. Mutation rates • Very low mutation rate • Therefore mutation alone will probably not account for the actual speed of evolutionary change observed in nature.

27. Mutation rates • But 150,000 genes in humans • 10-5 mutations per gene x 105 genes = 1 mutation per haploid genome in humans. • Probably an underestimate • If even a tiny fraction of there were advantageous, the amount of new “raw material” is substantial.

28. Mutation rates • Neutral Theory of molecular evolution • Mutations that neither enhance nor lower fitness • Fixed (go to 1) or lost (go to 0) entirely by chance • The probability that this will occur is u • That is, a mutation that occurred in the past will become fixed • After the passage of t generations the mutations that have become fixed would equal x = ut

29. Mutation rates • If 2 species diverged from a common ancestor t generations ago, the expected fraction of fixed mutations is D = 2ut • If we are talking bps then a fraction of D = 2ut of the bps of a gene should differ between species, assuming equal prob. of mutation.

30. Mutation rates • Avg. mutation rate per bp per generation is u = D/2t • Where D is the number of bp differences between 2 sequences • Human chimp split 1.3 x 10-9 per site per year (7mil) assuming 15-20 years generat.

31. Mutations • Then the mutation rate is 2 x10-8 per generation. • Human diploid genome has 6 x 109 nucleotide pairs, so this implies 120 new mutations per genome per generation. • Page 273 Futuyma

32. Phenotypic Effects of Mutation • Morphology • Physiology • Components of Fitness • Viability • Fertility • Developmental rate

33. Phenotypic Effects of Mutation • None • Synonymous substitution • Can effect fitness; rate of translation • Drastic • Eye color • Wing venation • Reduction in wing size

34. Phenotypic Effects of Mutation • Drastic • Behavior mutations in Bees • Larvae in cells, workers must remove dead, if not bacteria spreads thru the hive • Each behavior is abolished by a single dominant mutation abolishes • Homozygous recessive at two loci • Homeotic mutations: redirect the development of one body part into another

35. Phenotypic Effects of Mutation • Homeotic mutations: Antennapedia

36. Phenotypic Effects of Mutation

37. Phenotypic Effects of Mutation • Cause alterations in pre-existing traits • Mutations alter developmental processes • Do not alter developmental foundations that do not exist • Winged horses • angles

38. Effects of Mutation on Fitness • Extend from positive to very negative

39. Mutation • Mutation is a RANDOM process! • Not all conceivable mutations are equally likely to occur • Not all loci or regions within a locus are equally mutable • Environmental factors may influence the RATE of mutation (UV radiation, carcinogens, etc...)

40. Mutation is random in two senses • We can predict ONLY the PROBABILITY of a mutation occurring, but not which mutation will occur and when... • The chance that a particular mutation will occur is not influenced by whether or not the organism is in an environment in which that mutation would be advantageous!!!

41. The Environment Does NOT Induce Adaptive Mutation! • This idea is incorrect, and is called “Directed Mutation” which is basically Lamarkian evolution • Instead, the process takes the form of Darwin’s hypothesis • Spontaneous, random mutation, followed by natural selection!