paarweises sequenz alignment n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Paarweises Sequenz-Alignment PowerPoint Presentation
Download Presentation
Paarweises Sequenz-Alignment

Loading in 2 Seconds...

play fullscreen
1 / 19

Paarweises Sequenz-Alignment - PowerPoint PPT Presentation


  • 61 Views
  • Uploaded on

Paarweises Sequenz-Alignment. Variante: Lokales Alignment. Sinnvoll, wenn Sequenzen nur lokale Homologie haben. Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA Seq2 GGGACATGGCAGTGACTGACCATGA. Paarweises Sequenz-Alignment.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Paarweises Sequenz-Alignment' - yosef


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
paarweises sequenz alignment
Paarweises Sequenz-Alignment

Variante: Lokales Alignment. Sinnvoll, wenn Sequenzen nur lokale Homologie haben.

Seq1CTAATTAATGCACAGTTAGGAATTAGAAATGA

Seq2 GGGACATGGCAGTGACTGACCATGA

paarweises sequenz alignment1
Paarweises Sequenz-Alignment

Variante: Lokales Alignment. Sinnvoll, wenn Sequenzen nur lokale Homologie haben.

Seq1 CTAATTAATG-CACAGTTAGGAATTAGAAATGA

Seq2GGGAC ATGGCA--GTGACTGACCATGA

Aligne Paar von Segmenten der Sequenzen; ignoriere den Rest.

paarweises sequenz alignment2
Paarweises Sequenz-Alignment

Ziel beim lokalen Alignment: Finde Paar von Segmenten, so dass Alignment der Segmente maximalen Score hat.

Wichtigste Anwendung: Datenbank suche: Finde Sequenzen in der Datenbank, die zu gegebener Sequenz (Anfrage-Sequenz, query sequence) ähnlich sind.

paarweises sequenz alignment3
Paarweises Sequenz-Alignment

Exaktes lokales Alignment zu zeitaufwendig.

Schnelles Datenbank-Suchprogramm:

BLAST - Basic Local Alignment Search Tool

Stephen Altschul et al, JMB, 1990

21.778 Zitate in der Literatur !

Wichtigstes Werkzeug in der Bioinformatik!

paarweises sequenz alignment5
Paarweises Sequenz-Alignment

NCBI – National Center of Biotechnological Information

paarweises sequenz alignment6
Paarweises Sequenz-Alignment

BLAST - Basic Local Alignment Search Tool

Idee: Finde lokale Alignments ohne Gaps

(HSPs – high scoring segment pairs).

  • Suche kurze Wort-Paare (feste Länge)
  • Dehne Wort-Paare aus, bis Score abfällt
  • Berechne Wahrscheinlichkeit, HSP per Zufall zu finden: e-value, p-value
paarweises sequenz alignment7
Paarweises Sequenz-Alignment

Suche nach Wort-Paaren:

Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA

Seq2 GGGACATGGCAGTGACTGAATACACACCATGA

paarweises sequenz alignment8
Paarweises Sequenz-Alignment

Suche nach Wort-Paaren:

Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA

Seq2 GGGACATGGCAGTGACTGAATACACACCATGA

paarweises sequenz alignment9
Paarweises Sequenz-Alignment

Ausdehnung gefundener Wort-Paare:

Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA

Seq2 GGGACATGGCAGTGACTGAATACACACCATGA

paarweises sequenz alignment10
Paarweises Sequenz-Alignment

Ausdehnung gefundener Wort-Paare:

Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA

Seq2 GGGACATGGCAGTGACTGAATACACACCATGA

paarweises sequenz alignment11
Paarweises Sequenz-Alignment

Ausdehnung gefundener Wort-Paare:

Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA

Seq2 GGGACATGGCAGTGACTGAATACACACCATGA

paarweises sequenz alignment12
Paarweises Sequenz-Alignment

Ausdehnung gefundener Wort-Paare:

Seq1 CTAATTAATGCACAGTTAGGAATTAGAAATGA

Seq2 GGGACATGGCAGTGACTGAATACACACCATGA

TTAATGCACA

TGAATACACA

High-scoring segment pair (HSP)

paarweises sequenz alignment16
Paarweises Sequenz-Alignment

Verbesserung:

PSI-BLAST – Position Specific Iterative BLAST:

(18.708 Zitate in der Literatur!)

paarweises sequenz alignment17
Paarweises Sequenz-Alignment

PSI-BLAST – Position Specific Iterative BLAST:

  • “normale” DB-Suche mit BLAST
  • Bilde Positions-Gewichts-Matrix (PWM) aus “Treffern”
  • Suche mit PWM nach neuen “Treffern”
  • Bilde verbesserte PWM … u.s.w.