alignment n.
Skip this Video
Loading SlideShow in 5 Seconds..
ALIGNMENT PowerPoint Presentation
Download Presentation

Loading in 2 Seconds...

play fullscreen
1 / 37

ALIGNMENT - PowerPoint PPT Presentation

  • Uploaded on

ALIGNMENT. How do we tell whether two macromolecules are similar? Why?. SEQUENCE STRUCTURE FUNCTION. Alignments. DNA:DNA polypeptide:polypeptide. Alignments. One-to-One One-to-Database Many-to-Many. Origins of Sequence Similarity. Homology common evolutionary descent

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about 'ALIGNMENT' - jana

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript


How do we tell whether two macromolecules are similar? Why?




Chuck Staben

  • polypeptide:polypeptide

Chuck Staben

  • One-to-One
  • One-to-Database
  • Many-to-Many

Chuck Staben

origins of sequence similarity
Origins of Sequence Similarity
  • Homology
    • common evolutionary descent
  • Similarity in function
    • convergence
  • Chance




Chuck Staben





||||||| 7/7 OR 100%



||| ||| 6/7 OR 84%


Chuck Staben



||| ||| 6/7 OR 84%




||| ||| 6/7 OR 84%


Chuck Staben

terminal mismatch

Count this?

Terminal Mismatch


||| |||

aaaccGAATAAT 6/7 OR 84%

Chuck Staben





||| |||| 7/7 OR 100%



Chuck Staben

indels cont d



||| ||||


Indels, cont’d


||| ||||


Chuck Staben

similarity scoring
Similarity Scoring
  • Terminal mismatches (0)
  • Match score (10)
  • Mismatch penalty (-9)
  • Gap penalty (50)
  • Gap extension penalty (3)

DNA Defaults-Bestfit

Chuck Staben

dna scoring
DNA Scoring


|||||***** 5(10)-5(9)=5



|||||***** ||||| 10(10)-50-5(3)=35


Chuck Staben

absurdity of low gap penalty
Absurdity of Low Gap Penalty



Perfect similarity,

Every time!

Chuck Staben


Optimal Score=Optimal Alignment


Dynamic Programming

Optimal Local Alignment


Chuck Staben

    • Smith-Waterman
  • GAP
    • Needleman-Wunsch
    • End-to-end ALWAYS
    • COMPLETE surface of comparison

Chuck Staben

bestfit vs gap

1 ggggg 5


3 ggggg 7

1 ...gggggaaaaaggggccccc 19

|| |||| ||

1 gggggttttttttggggtttcc 22

Chuck Staben

statistical significance
Statistical Significance


Quality: 50 Length: 5

Similarity: 100.000 Identity: 100.000

Average quality, 20 randomizations: 34.2 +/- 9.4

Quality > RANDOM + 2()

Chuck Staben

program limitations
Program Limitations
    • 1000 vs 10,000
  • GAP
    • 1000 vs 1000
    • 1000 vs 1000


Chuck Staben

protein similarity
Protein Similarity
  • Identity-Easy

WEAK Alignments

  • Chemical Similarity
    • L vs I, K vs R…
  • Evolutionary Similarity

Chuck Staben

single base evolution
Single-Base Evolution





Chuck Staben

substitution matrices
Substitution Matrices
  • PAM-Dayhoff
  • BLOSUM-Henikoff

Chuck Staben

pam dayhoff
  • Related proteins, substitutions constrained by evolution and function
  • “accepted” by evolution (point accepted mutation)
  • 1 PAM::1% divergence
      • PAM120=closely related proteins
      • PAM250=divergent proteins
  • Log/odds approach

Chuck Staben

blosum henikoff henikoff
  • Align “BLOCKS”
  • Merge blocks at given % similar to one sequence
  • Calculate “target” frequencies
  • BLOSUM62=62% similar blocks
    • good general purpose
  • BLOSUM30
    • weak similarities

Chuck Staben


Chuck Staben

blosum62 2

Glu Asp Gln Lys Arg His Gly Ala



Chuck Staben

  • No general theory!!
  • G+L(n)
    • indel mutations rare
    • variation in length “easy”

Chuck Staben

alignment statistics
Alignment Statistics
  • Ungapped, local alignments (HSPs)
    • extreme value, not normal distribution
  • S(observed score) vs expected distribution p
  • E=expected number, chance alignments
  • K,  distribution parameters

“chance of finding a needle in a haystack depends on the size of the haystack”

Chuck Staben

real alignments
“Real” Alignments
  • Multiple HSPs
  • Karlin-Altshcul Sum Statistics
  • Heuristic qualities
    • alignments proceed end-to-end ????

Chuck Staben

real alignments1
Real Alignments




Chuck Staben




Chuck Staben

cow to pig

88% identical

Chuck Staben

cow to pig cdna
Cow-to-Pig cDNA

80% Identity

(88% at aa!)

Chuck Staben

coding vs non coding regions
Coding vs Non-coding Regions

90% in Coding

74% in Non-coding

Chuck Staben

third base of codon hypervariable
Third Base of Codon Hypervariable

28 third base

11 second

8 first

Chuck Staben

cow to fish protein
Cow-to-Fish Protein

42% identity

51% similairity

Chuck Staben

cow to fish dna
Cow-to-Fish DNA

48% similairity


Chuck Staben

protein vs dna alignments
Protein vs DNAAlignments
  • Polypeptide similarity > DNAs
  • Coding DNA > Non-coding
  • 3rd base of codon hypervariable
  • Moderate Distance 

poor DNA similarity

Chuck Staben