vivien
Uploaded by
22 SLIDES
552 VIEWS
220LIKES

Evolution

DESCRIPTION

Evolution. What is Evolution?. Evolution is a theory which states that all life forms change over many generations . The theory of evolution can not be tested using an experiment. Therefore, scientists rely on fossil evidence to support the theory. Evidence of Evolution.

1 / 22

Download Presentation

Evolution

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Evolution

  2. What is Evolution? • Evolution is a theory which states that all life forms change over many generations. • The theory of evolution can not be tested using an experiment. Therefore, scientists rely on fossil evidence to support the theory.

  3. Evidence of Evolution • Fossil-the remains of a plant or animal from an earlier time preserved in earth or rock. http://app.discoveryeducation.com/player/view?assetGuid=d808a54f-91e0-462f-a0cf-57744cc896cc&showBreadcrumbs=true

  4. Evidence of Evolution • Homologous structures- similar structures that related species have inherited from a common ancestor (ex: a human’s arm and a cat’s leg).

  5. Evidence of Evolution • Species that are related have similar fetal development patterns.

  6. Evidence of Evolution • The more similar the DNA of two species, the more closely related they are.

  7. Charles Darwin • In 1831, Charles Darwin began a 5 year trip around the world aboard the H.M.S. Beagle. • His goal was to observe and study new species of plants and animals.

  8. Charles Darwin • One of the stops was the Galapagos Islands. The ship spent 5 weeks there.

  9. Charles Darwin • Darwin noticed how there were many similarities, and differences, between the species living on the islands and the mainland.

  10. Charles Darwin • Darwin concluded that, over time, species must change based on their survival needs, to become better adapted.

  11. Natural Selection • In 1858, Darwin published his theory of natural selection. • Natural Selection states that individuals that are better adapted to their environment are more likely to survive and reproduce than the other members of the same species. http://app.discoveryeducation.com/player/view?assetGuid=462c367f-a499-4aee-bba9-01876f259e5a&showBreadcrumbs=true

  12. Natural Selection • Eventually, the majority of the members of the species will have those favorable traits and most of the unfavorable traits will disappear. http://app.discoveryeducation.com/player/view?assetGuid=6e3b381e-4c56-4e27-971c-9439653e7316&showBreadcrumbs=true • This is why natural selection is nicknamed “Survival of the Fittest”. http://science.discovery.com/games-and-interactives/charles-darwin-game.htm

  13. Selective Pressure • Selective Pressure is when environmental changes cause a species to evolve. • Selective pressure causes a species to change because individuals who are not well adapted to the changed environment die off, while individuals who are well adapted survive and reproduce. • The speed of the evolution is based on how drastic the environmental change was. http://www.techapps.net/interactives/peppermoths.htm http://app.discoveryeducation.com/player/view?assetGuid=aecb0580-3346-4081-9b18-655945e6f4a5&showBreadcrumbs=true

  14. Selective Breeding • Selective Breeding is when selective pressure is purposefully applied to a population to produce a desired outcome in the offspring. http://app.discoveryeducation.com/player/view?assetGuid=6e3b381e-4c56-4e27-971c-9439653e7316&showBreadcrumbs=true http://www.pbslearningmedia.org/asset/93b777ac-51d0-4580-bad2-311a74eb92b2.asset/

  15. Mutations • Mutation-a genetic change (a change in DNA). • Genetic variations, or mutations, are random and happen in every offspring generation.

  16. Mutations • Mutations cause a species to change because individuals with a helpful mutation will survive and pass it on to their offspring. Individuals with a harmful mutation will die. • The speed of the evolution is VERY slow (it takes thousands of years).

  17. Mutations • Assign each person a number at your table • Person 1 needs to copy down the following coded message on a piece of paper: • ATCGGCTAAAGGCTTCAAGCGGGGGCTATATATAGCGCCCCGCGCTATCTATCGATCAGATAGCTACGCTACGAGCTACGACTAGCATCGACGAT • Read the code to Person 2 (you can pause, but you can’t repeat). Person 2 needs to copy the code and read THEIR copy to Person 3. • Repeat until Person 4 has copied the code.

  18. Phylogenetic Trees • Phylogenetic trees are branching diagrams (or "trees“) that show evolutionary relationships among organisms. • Trees are created based on similarities and differences in physical characteristics and DNA. • Trees are usually in a cladogram form.

  19. Phylogenetic Trees • Cladograms are read from bottom to top (or sometimes left to right). • If the cladogram starts with a single line, that represents a common ancestor of all organisms in the diagram. COMMON ANCESTOR

  20. Phylogenetic Trees • Any place two lines meet represents a common ancestor, which eventually evolved into the organism at the end of the branch. EVOLVED INTO A CAMEL COMMON ANCESTOR

  21. Phylogenetic Trees • The organism closest to the starting branch is the one that evolved the earliest. • The organism furthest from the starting branch is the most recently evolved. MOST RECENTLY EVOLVED EVOLVED EARLIEST

  22. Phylogenetic Trees • According to this tree, how many common ancestors do cows and hippos have? • Which organism is the closest relative of the peccary? Closest common ancestor 4 Pig

More Related