Evolution - PowerPoint PPT Presentation

evolution n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Evolution PowerPoint Presentation
play fullscreen
1 / 22
Evolution
275 Views
Download Presentation
vivien
Download Presentation

Evolution

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Evolution

  2. What is Evolution? • Evolution is a theory which states that all life forms change over many generations. • The theory of evolution can not be tested using an experiment. Therefore, scientists rely on fossil evidence to support the theory.

  3. Evidence of Evolution • Fossil-the remains of a plant or animal from an earlier time preserved in earth or rock. http://app.discoveryeducation.com/player/view?assetGuid=d808a54f-91e0-462f-a0cf-57744cc896cc&showBreadcrumbs=true

  4. Evidence of Evolution • Homologous structures- similar structures that related species have inherited from a common ancestor (ex: a human’s arm and a cat’s leg).

  5. Evidence of Evolution • Species that are related have similar fetal development patterns.

  6. Evidence of Evolution • The more similar the DNA of two species, the more closely related they are.

  7. Charles Darwin • In 1831, Charles Darwin began a 5 year trip around the world aboard the H.M.S. Beagle. • His goal was to observe and study new species of plants and animals.

  8. Charles Darwin • One of the stops was the Galapagos Islands. The ship spent 5 weeks there.

  9. Charles Darwin • Darwin noticed how there were many similarities, and differences, between the species living on the islands and the mainland.

  10. Charles Darwin • Darwin concluded that, over time, species must change based on their survival needs, to become better adapted.

  11. Natural Selection • In 1858, Darwin published his theory of natural selection. • Natural Selection states that individuals that are better adapted to their environment are more likely to survive and reproduce than the other members of the same species. http://app.discoveryeducation.com/player/view?assetGuid=462c367f-a499-4aee-bba9-01876f259e5a&showBreadcrumbs=true

  12. Natural Selection • Eventually, the majority of the members of the species will have those favorable traits and most of the unfavorable traits will disappear. http://app.discoveryeducation.com/player/view?assetGuid=6e3b381e-4c56-4e27-971c-9439653e7316&showBreadcrumbs=true • This is why natural selection is nicknamed “Survival of the Fittest”. http://science.discovery.com/games-and-interactives/charles-darwin-game.htm

  13. Selective Pressure • Selective Pressure is when environmental changes cause a species to evolve. • Selective pressure causes a species to change because individuals who are not well adapted to the changed environment die off, while individuals who are well adapted survive and reproduce. • The speed of the evolution is based on how drastic the environmental change was. http://www.techapps.net/interactives/peppermoths.htm http://app.discoveryeducation.com/player/view?assetGuid=aecb0580-3346-4081-9b18-655945e6f4a5&showBreadcrumbs=true

  14. Selective Breeding • Selective Breeding is when selective pressure is purposefully applied to a population to produce a desired outcome in the offspring. http://app.discoveryeducation.com/player/view?assetGuid=6e3b381e-4c56-4e27-971c-9439653e7316&showBreadcrumbs=true http://www.pbslearningmedia.org/asset/93b777ac-51d0-4580-bad2-311a74eb92b2.asset/

  15. Mutations • Mutation-a genetic change (a change in DNA). • Genetic variations, or mutations, are random and happen in every offspring generation.

  16. Mutations • Mutations cause a species to change because individuals with a helpful mutation will survive and pass it on to their offspring. Individuals with a harmful mutation will die. • The speed of the evolution is VERY slow (it takes thousands of years).

  17. Mutations • Assign each person a number at your table • Person 1 needs to copy down the following coded message on a piece of paper: • ATCGGCTAAAGGCTTCAAGCGGGGGCTATATATAGCGCCCCGCGCTATCTATCGATCAGATAGCTACGCTACGAGCTACGACTAGCATCGACGAT • Read the code to Person 2 (you can pause, but you can’t repeat). Person 2 needs to copy the code and read THEIR copy to Person 3. • Repeat until Person 4 has copied the code.

  18. Phylogenetic Trees • Phylogenetic trees are branching diagrams (or "trees“) that show evolutionary relationships among organisms. • Trees are created based on similarities and differences in physical characteristics and DNA. • Trees are usually in a cladogram form.

  19. Phylogenetic Trees • Cladograms are read from bottom to top (or sometimes left to right). • If the cladogram starts with a single line, that represents a common ancestor of all organisms in the diagram. COMMON ANCESTOR

  20. Phylogenetic Trees • Any place two lines meet represents a common ancestor, which eventually evolved into the organism at the end of the branch. EVOLVED INTO A CAMEL COMMON ANCESTOR

  21. Phylogenetic Trees • The organism closest to the starting branch is the one that evolved the earliest. • The organism furthest from the starting branch is the most recently evolved. MOST RECENTLY EVOLVED EVOLVED EARLIEST

  22. Phylogenetic Trees • According to this tree, how many common ancestors do cows and hippos have? • Which organism is the closest relative of the peccary? Closest common ancestor 4 Pig