synthetic biology n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Synthetic Biology PowerPoint Presentation
Download Presentation
Synthetic Biology

Loading in 2 Seconds...

play fullscreen
1 / 43

Synthetic Biology - PowerPoint PPT Presentation


  • 170 Views
  • Uploaded on

Synthetic Biology. Lecture 1: Introduction to Synthetic Biology. What is Synthetic Biology?. Genetic Manipulation? Genetic selection carried out for millenia (domestication of animals) Mendelian selection ‘rationalized’ process. Recombinant DNA .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Synthetic Biology' - tyrone


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
synthetic biology

Synthetic Biology

Lecture 1: Introduction to Synthetic Biology

what is synthetic biology
What is Synthetic Biology?
  • Genetic Manipulation?
  • Genetic selection carried out for millenia (domestication of animals)
  • Mendelian selection ‘rationalized’ process.
  • Recombinant DNA
slide3
Engineering Goal: To build components that can be reliably and predictably assembled into ever more complicated systems
fumbling around
Fumbling Around
  • Current Systems are “Art”
composability
Composability
  • OK - suppose we have individual parts that work, can we actually put them together such that they work in a well-defined/predictable way?
standardization
Standardization
  • Assembly
  • Part “Definition”
  • Interactions
    • Load
    • Input/Output
    • Stability
standardizing a part
Standardizing a “Part”
  • BioBrick - standard ends, restrictions on internal sequence
what constitutes a part
What constitutes a part?
  • The DNA Sequence?
  • The function?
dna sequence
DNA Sequence
  • TAATACGACTCACTATAGGGAGA

(T7 promoter)

load imposing on our hosts
Load: Imposing on our Hosts
  • Parts don’t exist in a vacuum.
  • Cells may dislike the parts, resulting in mutation or rejection
  • Too much modification may result in cells that just give up and die
our parts aren t necessarily stable
Our Parts aren’t necessarily Stable
  • Anything that adds load to a cell reduces its fitness vs. cells that ‘lose’ the part
    • Mutations: Losing a plasmid, alteration of promoters to not work as efficiently (or not at all)
    • Antibiotic resistance, dependence
application goals
Application Goals
  • Bacterial robotics
  • Microbial factories
  • Adding features to plants to reduce environmental requirements/impact
public policy
Public Policy

http://www.repeatfanzine.co.uk/Images/Impage/no%20gmo.jpg

is the fear so irrational
Is the fear so Irrational?
  • We claim we can make all sorts of cool things, why not something ‘evil’?
what is different now
What is different now?
  • Rapid Sequencing
  • Lots of sequence data on the internet
  • Protocols available online
  • Fedex Synthesis
  • Data on Pathogens?
the good news
The good news

Major weaponized biological agents have existed for decades

Virulence, resistance, transmissibility were all enhanced prior to SB.

The major advantage of our approach is putting together well characterized components.

Creating new pathogens would require a full scale research effort

summary
Summary
  • Engineering instead of Science
  • Modularity and Abstraction are powerful techniques
  • Mechanical Engineering, Electrical Engineering were all at the stage where it was “too complicated”.