html5-img
1 / 20

Synthetic Biology

Synthetic Biology. Sergio Peisajovich Lim Lab June 2007. Synthetic Biology. What is Synthetic Biology?. It is an emerging field of biology that aims at designing and building novel biological systems.

logan-frank
Download Presentation

Synthetic Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Synthetic Biology Sergio Peisajovich Lim Lab June 2007

  2. Synthetic Biology What is Synthetic Biology? It is an emerging field of biology that aims at designing and building novel biological systems. The final goal is to be able to design biological systems in the same way engineers design electronic or mechanical systems.

  3. Synthetic Biology Why do we need it? “What I cannot create, I do not understand.” - Richard Feynman

  4. Synthetic Biology Why do we need it? Cells are the ultimate Chemical Factory.

  5. Synthetic Biology Is it achievable? 1- Biology is hierarchical

  6. Synthetic Biology Is it achievable? 2- Biology is Modular

  7. Synthetic Biology Is it achievable? Hierarchy and Modular (recurrent) organization allows biology to be understandable and synthetic biology to be possible.

  8. Synthetic Biology A possible hierarchy for synthetic biology

  9. Synthetic Biology Biological Components: 1-Parts

  10. Synthetic Biology Biological Components: 2-Devices

  11. Synthetic Biology Biological Components: 3-Systems or Modules

  12. Synthetic Biology Biological Components: 3-Systems or Modules Basu et al (2005) Nature, 434: 1130-4)

  13. Synthetic Biology Biological Components: 3-Systems or Modules

  14. Synthetic Biology Biological Components: 3-Systems or Modules

  15. Synthetic Biology Synthetic Biology as Engineering For synthetic biology to become a form of engineering it will be necessary to achieve precision and reliability. Factors preventing this: 1- Incomplete knowledge of biology. 2- Inherent functional overlap (parts with many -some unknown- functions, some of which are detrimental to the goal in mind. 3- Incompatibility between parts. 4- Parts functionality depends on context. 2- CI represses expression of unrelated host genes 3- LuxR interacts with CI and blocks its function 4- GFP is non-fluorescent in host

  16. Synthetic Biology Parts should not have multiple functions (One subunit of T7 phage DNA polymerase is actually E. coli thioredoxin) Parts should not encode multiple functions Synthetic Biology as Engineering Standard Parts

  17. Synthetic Biology Different parts should be compatible Parts should work in different contexts Synthetic Biology as Engineering Standard Parts

  18. Synthetic Biology Synthetic Biology as Engineering Standard Parts Standardized parts could be easily exchanged between different devices (as well as between different laboratories)

  19. Synthetic Biology Synthetic Biology as Engineering Abstraction Systems Devices Parts DNA TGCATGCTGATATACGGCTCGAT

  20. Synthetic Biology

More Related