slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Biotechnology Gel Electrophoresis PowerPoint Presentation
Download Presentation
Biotechnology Gel Electrophoresis

Loading in 2 Seconds...

play fullscreen
1 / 18

Biotechnology Gel Electrophoresis - PowerPoint PPT Presentation


  • 183 Views
  • Uploaded on

Biotechnology Gel Electrophoresis. Many uses of restriction enzymes…. Now that we can cut DNA with restriction enzymes… we can cut up DNA from different people… or different organisms… and compare it why? ________________________ ________________________ ________________________

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Biotechnology Gel Electrophoresis' - trang


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Biotechnology

Gel Electrophoresis

many uses of restriction enzymes
Many uses of restriction enzymes…
  • Now that we can cut DNA with restriction enzymes…
    • we can cut up DNA from different people… or different organisms… and compare it
    • why?
      • ________________________
      • ________________________
      • ________________________
      • ________________________
      • ________________________
comparing cut up dna
Comparing cut up DNA
  • How do we compare DNA fragments?
    • _________________________________
  • How do we separate DNA fragments?
    • run it through a gelatin
    • ________________________
  • How does a gel work?
gel electrophoresis
Gel electrophoresis
  • A method of separating DNA in a gelatin-like material using an electrical field
    • _______________________
    • when it’s in an electrical field it moves toward the positive side

DNA       

+

“swimming through Jello”

gel electrophoresis5
Gel electrophoresis
  • DNA moves in an electrical field…
    • so how does that help you compare DNA fragments?
      • _______________________________________
        • ____________________________________________
        • ____________________________________________

DNA       

+

“swimming through Jello”

gel electrophoresis6
Gel Electrophoresis

DNA &restriction enzyme

-

longer fragments

wells

power

source

gel

shorter fragments

completed gel

+

running a gel

fragments of DNAseparate out based on size

Running a gel

Stain DNA

  • ethidium bromide binds to DNA
  • fluoresces under UV light

cut DNA with restriction enzymes

1

2

3

dna fingerprint
DNA fingerprint
  • Why is each person’s DNA pattern different?
    • sections of “junk” DNA
      • doesn’t code for proteins
      • made up of repeated patterns
        • CAT, GCC, and others
        • each person may have different number of repeats
      • many sites on our 23 chromosomes with different repeat patterns

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT

CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT

CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

dna patterns for dna fingerprints

Allele 1

cut sites

repeats

cut sites

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT

CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT

CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA

DNA patterns for DNA fingerprints

Cut the DNA

1

2

3

+

DNA

allele 1

differences between people
Differences between people

Person 1

cut sites

cut sites

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT

CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

Person 2: more repeats

GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACGCTT

CGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

1

2

3

DNA fingerprint

+

DNA

person 1

person 2

uses evolutionary relationships

1

2

3

4

5

1

2

3

4

5

Uses: Evolutionary relationships
  • Comparing DNA samples from different organisms to measure evolutionary relationships

turtle

snake

rat

squirrel

fruitfly

DNA

+

uses medical diagnostic
Uses: Medical diagnostic
  • Comparing normal allele to disease allele

chromosomewith normal allele 1

chromosome with disease-causing allele 2

allele 2

allele 1

DNA

Example: test for Huntington’s disease

+

uses forensics
Uses: Forensics
  • Comparing DNA sample from crime scene with suspects & victim

suspects

crime scene sample

S1

S2

S3

V

DNA

+

dna fingerprints
DNA fingerprints
  • Comparing blood samples on defendant’s clothing to determine if it belongs to victim
    • __________________
rflp electrophoresis use in forensics
RFLP / electrophoresis use in forensics
  • 1st case successfully using DNA evidence
    • 1987 rape case convicting Tommie Lee Andrews

“standard”

semen sample from rapist

blood sample from suspect

“standard”

How can you compare DNA fromblood & from semen?RBC?

“standard”

semen sample from rapist

blood sample from suspect

“standard”

electrophoresis use in forensics
Electrophoresis use in forensics
  • Evidence from murder trial
    • Do you think suspect is guilty?

blood sample 1 from crime scene

blood sample 2 from crime scene

blood sample 3 from crime scene

“standard”

blood sample from suspect

blood sample from victim 1

blood sample from victim 2

“standard”

uses paternity

Mom

F1

F2

child

Uses: Paternity
  • Who’s the father?

DNA

+

slide18

I’m a-glow!

Got any Questions?