1 / 29

Exploring Light-Gated Proton Channels for Cell-Cell Communication in Synthetic Biology Research

Dive into the world of synthetic biology research in Summer 2012 with Ben Clarkson to study light-based communication between cells using fast, specific wavelengths and sensitive mechanisms like Proton Channels/Pumps. Explore pH-sensitive promoters and more to understand how to utilize light for cell communication.

tiger
Download Presentation

Exploring Light-Gated Proton Channels for Cell-Cell Communication in Synthetic Biology Research

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Synthetic Biology Research Summer 2012 Ben Clarkson

  2. Cell-Cell Communication • Light • Fast, specific (wavelengths), sensitive • How to use light to communicate between cells?

  3. Proton Channels/Pumps • Light-gated • e-BO • 560 nm

  4. pH sensitive promoters: cadA cadAP cadB cadA CadC Cad1 Cad2

  5. pH sensitive promoters: cadA cadB cadA CadC CadC Cad1 Cad2

  6. pH sensitive promoters: cadA cadB cadA H+ H+ H+ H+ H+ CadC Cad1 Cad1 Cad1 Cad2 Cad2 Cad2

  7. pH sensitive promoters: cadA cadB cadA H+ H+ H+ H+ H+ CadC Cad1 Cad2

  8. pH sensitive promoters: cpxP cpxP CpxP CpxA CpxR DegP

  9. pH sensitive promoters: cpxP cpxP CpxP At high pH: 1. DegP breaks down cpxP DegP

  10. pH sensitive promoters: cpxP cpxP CpxP CpxA CpxR At high pH: DegP breaks down cpxP CpxA (no longer inhibited by cpxP) phosphorylates CpxR DegP

  11. pH sensitive promoters: cpxP cpxP CpxP CpxA CpxR At high pH: DegP breaks down cpxP CpxA (no longer inhibited by cpxP) phosphorylates CpxR CpxR activates cpxP (as well as DegP) DegP

  12. ScpxP LcpxP

  13. Assembling Promoters: Colony PCR Forward Primer 5'-GCATGAATTCGCGGCCGCTTCTAGAG-CTCAAGGCCGAGAACGCGATCAAGTTCACTGCCGCGCGCCGTCAACATAATGACAGGCGTCTGGTGTGTCTGGCGAAGTGCTTTTAATGTGTCGATACCATTTTTCTTCGGCATCATTACGTCAAGCAAAAGTAAATCAATGCTGTCGTCCAGAAGATCAAGCGCCTGTTCCCCATCGTGGGCAACAATCACGTTGAAGCCTTCCATCTCGAGCAGCTCCTTTAATAGGGAAGTCAGCTCTCGGTCATCATCAACTAACAGGATTTTATTCATTGTTTAAATACCTCCGAGGCAGAAATTACGTCATCAGACGTCGCTAATCCATGACTTTACGTTGTTTTACACCCCCTGACGCATGTTTGCAGCCTGAATCGTAAACTCTCTATCGTTGA-3' 3‘- GAGTTCCGGCTCTTGCGCTAGTTCAAGTGACGGCGCGCGGCAGTTGTATTACTGTCCGCAGACCACACAGACCGCTTCACGAAAATTACACAGCTATGGTAAAAAGAAGCCGTAGTAATGCAGTTCGTTTTCATTTAGTTACGACAGCAGGTCTTCTAGTTCGCGGACAAGGGGTAGCACCCGTTGTTAGTGCAACTTCGGAAGGTAGAGCTCGTCGAGGAAATTATCCCTTCAGTCGAGAGCCAGTAGTAGTTGATTGTCCTAAAATAAGTAACAAATTTATGGAGGCTCCGTCTTTAATGCAGTAGTCTGCAGCGATTAGGTACTGAAATGCAACAAAATGTGGGGGACTGCGTACAAACGTCGGACTTAGCATTTGAGAGATAGCAACT-ATGATCATCGCCGGCGACGTCTACG-'5 Reverse Primer

  14. Forward Primer Reverse Primer

  15. Forward Primer Reverse Primer Promoter sequence

  16. PCR (template DNA=colony PCR products) Colony PCR Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter Promoter

  17. Ligation into Plasmid XbaI SpeI Superfolder GFP with LVA (J119041) EcoRI PstI pSB1A8

  18. EcoRI PstI XbaI SpeI XbaI SpeI Superfolder GFP with LVA (J119041) EcoRI PstI pSB1A8

  19. Success! EcoRI PstI XbaI SpeI XbaI SpeI Superfolder GFP with LVA (J119041) pSB1A8

  20. Testing Promoters

  21. GFP RBS

  22. cadA (J100071)

  23. LcpxP (J100072)

  24. ScpxP (J100073)

  25. Linking pH and Light LRE RBS RBS Green luciferase J100088: cadA promoter J100089: LcpxP promoter

  26. What next? • Repeat experiment • Spacing • Different plates • Other variables to test: • LysP represses CadC • Lysine=another variable? • Luciferin • Retinal

  27. Bacterioopsin vs. Bacteriorhodopsin: Moving Forward • Adding retinal • Cells with bacteriorhodopsin? • Repeat experiment

More Related