Chapter 13 Genetic Engineering
Chapter 13 Genetic Engineering. 13–2 Manipulating DNA. A. The Tools of Molecular Biology 1. DNA Extraction 2. Cutting DNA 3. Separating DNA B. Using the DNA Sequence 1. Reading the Sequence 2. Cutting and Pasting 3. Making Copies. Extracting DNA.
Chapter 13 Genetic Engineering
E N D
Presentation Transcript
13–2 Manipulating DNA • A. The Tools of Molecular Biology • 1. DNA Extraction • 2. Cutting DNA • 3. Separating DNA • B. Using the DNA Sequence • 1. Reading the Sequence • 2. Cutting and Pasting • 3. Making Copies
Extracting DNA • How can we get DNA out of a cell or cells?
1. Copy the following series of DNA nucleotides onto a sheet of paper. • GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA • 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. • 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?
DNA can be cut into segments using restriction enzymes. • Bacteria have been battling viral infections for millions of years. There defense is to cut up the DNA of the virus by using enzymes.
Recognition sequences Restriction enzymeEcoRIcuts the DNA into fragments. Sticky end
Separating DNAGel electrophoresis Power source DNA plus restriction enzyme Longer fragments Shorter fragments Mixture of DNA fragments
Longer fragments will move ____________ than shorter fragments.
Figure 13-7 DNA Sequencing DNA sequencing Section 13-2
Making recombinant DNA Section 13-3 Gene for human growth hormone Recombinant DNA Gene for human growth hormone DNA recombination Human Cell Sticky ends DNA insertion Bacterial Cell Bacterial chromosome Bacterial cell for containing gene for human growth hormone Plasmid
Interest Grabber The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey. Section 13-4
Flowchart Section 13-4 Cloning A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The fused cell begins dividing, becoming an embryo. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal.
Figure 13-13 Cloning of the First Mammal Section 13-4 A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell Egg Cell The nucleus of the egg cell is removed. An egg cell is taken from an adult female sheep. The fused cell begins dividing normally. Embryo Cloned Lamb The embryo is placed in the uterus of a foster mother. The embryo develops normally into a lamb—Dolly Foster Mother
Can you imagine penguin clones!