media
Uploaded by
58 SLIDES
913 VIEWS
610LIKES

Chapter 13: Genetic Engineering

DESCRIPTION

Chapter 13: Genetic Engineering. Modifying offspring’s appearance at the NON-DNA level. Selective Breeding HOW: allowing only those animals with desired characteristics to produce the next generation Pros: t akes advantage of naturally occurring genetic variation in organisms

1 / 58

Download Presentation

Chapter 13: Genetic Engineering

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 13: Genetic Engineering

  2. Modifying offspring’s appearance at the NON-DNA level • Selective Breeding • HOW: allowing only those animals with desired characteristics to produce the next generation • Pros: takes advantage of naturally occurring genetic variation in organisms • Cons: No guarantee you get what you want • EX: Breeding the winners of a horse race

  3. Hybridization • HOW: Crossing organisms of different traits to produce a hardier product • Pros: can get “best of both worlds” • Cons: not guaranteed you get desired traits • EX: A mule is a cross of a horse and a donkey – Sturdy (donkey) and surefooted (horse) • EX: Hybrid corn – tastes good and is more resistant to disease.

  4. ZEBROID • Cross between a zebra and a horse • Aka “zebra mule”, “zebrule”, “zorse”

  5. Jostaberry • Hybrid between gooseberry and blackcurrant +

  6. Broccoflower • Broccoli + cauliflower + =

  7. Chuman / Manpanzee • Chuman – male chimp, female human • Manpanzee- male human, female chimp • HYPOTHETICAL SPECIES • (not real)

  8. Why it doesn’t work • Wrong number of chromosomes • Sperm cannot penetrate egg • Post-zygotic reproductive barriers • Even if the egg got fertilized, it wouldn’t be recognized by mother and would spontaneously abort

  9. Inbreeding • HOW: Maintaining the present genes by breeding only within the population • Pros: Keeps family traits you want • Cons: recessive traits showing up that may be lethal or harmful. • EX: Pedigree animals

  10. Inducing mutations • How: using radiation & chemicals to alter DNA and force mutations to occur • Pros: new phenotypes • Concerns: Not a sure bet nor do you know what you are going to get • EX: Polyploidy (3N or 4N) plants have resulted from this – larger & hardier

  11. Selective Breeding Hybridization Inducing Mutations Inbreeding

  12. PROCESS BOX 13-1 What are two similarities between the four methods above? What are two differences between the four methods above? MUST BE AT LEAST 4 LINES LONG

  13. Glofish: the first genetically modified animal to be sold as a pet

  14. Modifying an organism directly at the DNA level • DNA Technology – science involved in the ability to manipulate genes/DNA • Purpose: • Cure disease (Cystic Fibrosis) • Treat genetic disorders (Hemophilia, diabetes) • Improve food crops (better tasting, longer shelf life, fungus resistance…) • Improve human life in general

  15. YOU CHOOSE! • Notecards (with pocket glued to notebook) • Vocab foldable

  16. The Tools: • DNA Extraction – Chemical procedure to remove DNA • Restriction enzymes– molecular scissors that cut DNA at specific nucleotide sequences • Gel Electrophoresis– method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve) • DNA Ligase – molecular glue that puts pieces of DNA together • Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr

  17. Treatment of diseases • Several diseases have been “treated” in the past • Diabetics—injections of insulin from sheep • Problems?

  18. Treatment of Diseases • Several diseases have been “treated” in the past • Dwarfism– using hormones from pituitaries of cadavers • Problems

  19. Treatment of Diseases • Several diseases have been “treated” in the past • Hemophilia—using blood clotting factors from blood transfusions • Problems?

  20. New method of treating diseases • Overall Scheme: get bacteria to make what you want, harvest from bacteria • Called Recombinant DNA Technology

  21. What are restriction enzymes? • Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria). • Different bacteria make different enzymes • Restriction enzymes recognize a specific short nucleotide sequence called a recognition site • Palindromes same base pairing forward and backwards

  22. Blunt & Sticky ends • Sticky ends – Creates an overhang. • EX: EcoRI • Blunt Ends- Enzymes that cut at precisely opposite sites without overhangs. • EX:SmaI

  23. PROCESS BOX 13-2 • Do you think that blunt ends or sticky ends are easier to reconnect? Why? MUST BE AT LEAST 2 LINES LONG

  24. Recombinant DNA technology • Isolate gene of interest from human (or other organism) • Cut with restriction enzyme • Cut cloning vector (bacterial plasmid or viral DNA) • Cut with same restriction enzyme • Want a genetic marker present (allows identification)

  25. Donor Gene Recombinant DNA technology • “Glue” gene of interest onto cloning vector • DNA ligase puts them together • At this point, you have created a piece of Recombinant DNA • Recombinant DNA - DNA with new piece of genetic information on it

  26. Recombinant DNA technology • Cloning vector goes into bacterium • Bacteria is called a transgenic organism--organism with foreign DNA incorporated in its genome (genes) • Screen for the bacteria that did transform by using genetic marker (antibiotic resistance) • Bacteria makes protein from gene of interest • Protein is used

  27. Ms. Lichtenwalner’s Maple Pig™ Dream

  28. PROCESS BOX 13-4 • Explain how to make Ms. Lichtenwalner’sMaplePig™ using the five steps of recombinant DNA technology above. Be as specific as possible. MUST BE AT LEAST 8 LINES LONG

  29. Benefits of DNA technology • Pharmaceutical products – insulin, HBCF (human blood clotting factor) • Genetically engineered vaccines – to combat viral infections (pathogenic – disease causing) • body recognizes foreign proteins, produces antibodies • Prevents future illness

  30. Benefits of DNA technology • Increasing agricultural yields –GMO – Genetically modified • Insect-resistant plants • Disease resistant plants • Herbicide resistant plants • Increase N fixation • Salt tolerant plants

  31. Benefits of DNA technology • Improve quality of produce • Slow down the ripening process – ship when un-ripened, to market when ripe • Enhance color of produce • Reduce hairs or fuzz on produce • Increase flavor • Frost resistance

  32. Negatives of DNA Technology • Food allergies • EX: May have peanut products in a non-peanut food and NOT KNOW! • FDA does not require that on a label (here in the US) • Also, may create “superweeds” that cross pollinate with others & may take over environment • Genetic resistance to our ways of chemically removing them • Health effects down the road?

  33. PROCESS BOX 13-4 • Do you think that the benefits of DNA technology outweigh the negatives of DNA technology? Defend you answer with two examples. MUST BE AT LEAST 3 LINES LONG

  34. Cloning—more DNA tech • What is it? • Growing a population of genetically identical cells from a single cell. • Landmark year • 1997 - Ian Wilmut with Dolly, the cloned sheep • First cloned mammal

  35. Cloning Process • Remove nucleus from egg cell • Fuse de-nucleated cell with a body cell from another adult • Cells become 2N and then divides • Implant embryo in reproductive system of foster mother

  36. Hello Dolly!

  37. PROCESS BOX 13-6 • Congress thinks the country has gone to shambles, and they plan to clone George Washington, the “first” (actually 7th) president of the United States. In the space below, outline a plan that explains how George Washington could be cloned. MUST BE AT LEAST 3 LINES LONG

  38. Polymerase Chain Reaction • Makes many copies of one piece of DNA by repeating replication

  39. DNA Fingerprinting—more DNA tech • Using cut DNA at specific sites to determine the source of the DNA. • Analyzes sections of DNA that have little to no function but vary greatly from one person to the next (called repeats) • RFLP analysis – We’ll do this in lab

  40. DNA Fingerprinting • RFLP analysis– Restriction fragment length polymorphism. We each have non-coding segments on our DNA. • Extract DNA sample from blood or tissues • Cut DNA using restriction enzymes. Fragment lengths varies with each person • Separate fragments by gel electrophoresis– separates DNA fragments by the # of base pairs (length of the fragment) and charge

  41. DNA Fingerprinting • Place DNA sample into wells in the agarose gel – molecular sieve • Run a current through the gel. The DNA (negatively charged) will migrate from (-) to (+) • The larger fragments will not migrate that far. The small fragments will go the furthest. • Stain gel and bands in a dye or use a radioactive probe to analyze the banding

  42. Variable Number Tandem Repeat • Aka VNTR • Small segments of DNA that are repeatedover and over • Varies from individual to individual • What is the repeat in this sequence? • TAACGTAACGTAACGTAACGTAACGTAACG

More Related