El dogma central de la Biología Molecular: - PowerPoint PPT Presentation

slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
El dogma central de la Biología Molecular: PowerPoint Presentation
Download Presentation
El dogma central de la Biología Molecular:

play fullscreen
1 / 48
El dogma central de la Biología Molecular:
285 Views
Download Presentation
salaam
Download Presentation

El dogma central de la Biología Molecular:

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. El dogma central de la Biología Molecular:

  2. DESCUBRIMIENTO DE DNA: • Friederich Miescher aisla molécula que contiene fósforo desde pus. • Contenía una fracción básica (DNA) y proteína. • Encontró la misma sustancia en la cabeza de espermios de salmón.

  3. Pero: ¿cuál es la molécula que porta la información genética ?? Experimento Avery Macleod McCarthy

  4. Experimento Heavy Chase: más evidencia para el ADN como material genético

  5. CHARGAFF: DETERMINA QUE INDEPENDIENTE DE LA COMPOSICIÓN EN BASES DEL ADN: SIEMPRE EL NÚMERO DE G=C Y A= T Ó U ESTUDIOS DE DIFRACCIÓN DE RAYOS X: FUNDAMENTALES EN DESCIFRAR ESTRUCTURA ADN

  6. 1953:

  7. FUNCIONES DE LOS NUCLEOTIDOS: • MONEDA DE INTERCAMBIO ENERGÉTICO. • COMPONENTE DE LOS ÁCIDOS NUCLEICOS: ADN Y ARN GENES RNA MENSAJERO RNA DE TRANSFERENCIA RNA RIBOSOMAL RNA DE INTERFERENCIA

  8. ENLACE FOSFODIESTER: • UNIÓN ÉNTRE NUCLEÓTIDOS PARA FORMAR ÁCIDOS NUCLEICOS. • SE FORMA ENTRE EL FOSFATO 5´ Y EL OH 3`. • ESQUELETO FOSFATO-PENTOSA: • BASES A LOS LADOS. • ALTAMENTE POLAR • pKa fosfato muy bajo: implica ionización y carga negativa El RNA es muchísimo más inestable que DNA

  9. EJEMPLO: HIDRÓLISIS ALCALINA DE RNA:

  10. POR CONVENCIÓN SIEMPRE SE ESCRIBEN LAS ESTRUCTURAS DE ÁCIDOS NUCLEICOS EN SENTIDO 5´-3´. UN ÁCIDO NUCLEICO CORTO SE DENOMINA OLIGONUCLEOTIDO (HASTA 50 NUCLEÓTIDOS). 5´ GCCCCTTTTTATCGAATTACCC 3´

  11. PROPIEDADES DE BASES QUE INFLUYEN EN LAS DEL ÁCIDO NUCLEICO:

  12. DENATURACIÓN DE ADN: