Mlpa multiplex ligation dependent probe amplification
Download
1 / 39

MLPA ( Multiplex ligation – dependent probe amplification ) - PowerPoint PPT Presentation


  • 280 Views
  • Uploaded on

MLPA ( Multiplex ligation – dependent probe amplification ). Peter Böhm Nielsen. Generelt analyseflow. MLPA. Anvendte metoder. HRM & Sanger sekventering. Allel 1. Allel 2. Allel 1. MLPA (Multiplex Ligation-dependent Probe Amplification). Allel 2.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'MLPA ( Multiplex ligation – dependent probe amplification )' - raven-booth


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Mlpa multiplex ligation dependent probe amplification

MLPA(Multiplexligation – dependent probeamplification)

Peter Böhm Nielsen


Generelt analyseflow
Generelt analyseflow

MLPA


Anvendte metoder
Anvendte metoder

HRM & Sanger sekventering

Allel 1

Allel 2

Allel 1

MLPA (Multiplex Ligation-dependent Probe Amplification)

Allel 2


Multiplex ligation dependent probe amplification mlpa
Multiplex Ligation-Dependent Probe Amplification (MLPA)

  • MLPA er en teknik til kopitalsbestemmelse af specifikke sekvenser. Dette sker ved simultan binding af op til 45 prober, hvorefter det relative antal af bundne prober bestemmes.

  • Til udførelsen benyttes PCR amplifikation.


Mlpa probe hybridisering
MLPA Probehybridisering

1

Promoter Exon 1 Intron 1 Exon 2 Intron 2 Exon 3

2

Promoter Exon 1 Intron 1 Intron 2 Exon 3


Mlpa 1 multiplex ligation depending probe amplification
MLPA (1)MultiplexLigationdependingProbeAmplification

  • Denaturering

  • Hybridisering

  • Ligering

  • Amplifikation

  • Fragment-analyse



Hybridisering
Hybridisering

  • MLPA probemixblandes med denatureretgenomisk DNA.

  • De to sammenhørende prober hybridiserestiltilstødende target sekvenser


Ligering
Ligering

3. Prober ligeressammenaf en thermostabilligase.


Amplifikation
Amplifikation

  • Et universelt primer par benyttestilamplifikationafalleligerede prober.

    Hvertamplifikatfrahver probe har en uniklængde (130 - 480 bp).


Separation og kvantitering ved kapill r elektroforese
Separation ogkvantiteringvedkapillærelektroforese

Hver top er et amplifikatfra en specifik probe .

Prøvernesammanlignes med en kontrolprøve.

En forskelirelativtophøjde/areal indikerer en ændringikopitalaf den gældende probes target sekvens.







Normal mlpa
Normal MLPA


Mlpa deletion af exon 5 7
MLPA Deletion af exon 5-7


Mlpa deletion af exon 3 16
MLPA Deletion af exon 3-16


Mlpa duplikation af exon 13
MLPA Duplikation af exon 13


Hvad kan dette v re
Hvad kan dette være ?


Kan dette v re rigtigt
Kan dette være rigtigt ?

Det er ikke sandsynligt at ovenstående er deletioner, da proberne mellem de 2 exons har korrekt amplifikationsstatus.


Mlpa probe hybridisering 2
MLPAProbehybridisering (2)

Stuffer sekvens

OH

P

ACGTACGCACCT

CCTTGATTTGGAC

AGTTGGAACTAAACCTGTGCATGCGTGGATTTC

Gen specifikke prober

Kontroller

Prober forsøges designet udenfor SNP’s



Anvendte metoder1
Anvendte metoder

HRM & Sanger sekventering

Allel 1

Allel 2

Allel 1

MLPA (Multiplex Ligation-dependent Probe Amplification)

Allel 2


Materialer og metoder cish og fish for her 2 amplifikation 1
Materialer og metoder CISH og FISH for HER-2 amplifikation (1)


Materialer og metoder cish og fish for her 2 amplifikation 2
Materialer og metoder CISH og FISH for HER-2 amplifikation (2)

Farshid.


Materialer og metoder pr vemateriale 1
Materialer og metoder (Prøvemateriale (1))


Materialer og metoder pr vemateriale 2 hematoxylin og eosin farvning he
Materialer og metoder (Prøvemateriale (2))Hematoxylin og eosin-farvning (HE)

Cancerceller kan ”fortyndes” i normale celler

Hvad har det af betydning ?


Resultater normal
ResultaterNormal


Resultater amplificeret
Resultater Amplificeret


Resultater mlpa vs ish
ResultaterMLPA vs. ISH


Kvalitetssikring af resultatet quantity peaks
Kvalitetssikring af resultatet Quantity-peaks

Q-peaks: 64, 72, 76 & 82 – indikerer DNA mængde

Uafhængig af ligering


Kvalitetssikring af resultatet denaturing peaks
Kvalitetssikring af resultatet Denaturing-peaks

TE TE+50mM NaCl TE+75mM NaCl

D-peaks: 88, 92 & 96 – indikerer DNA kvalitet og ligerings-reaktion

Afhængig af DNA &ligering

D-prober er placeret tæt på CpG-island – kræver meget energi ved denatureringen


Raw data vurdering sloping
Raw-data vurdering (sloping)

God amplifikation

Uensartet amplifikation

Resultater med samme signal-niveau er bedst at sammenligne.

Sloping er OK til et vist punkt, hvis normalisering kan udføres.

Kan skyldes fordampning – test med 8µl vand.



Skuldre
”Skuldre”

Degradering af ligerede prober: Kør MLPA-analysen direkte efter fortynding i formamid


ad