mlpa multiplex ligation dependent probe amplification n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
MLPA ( Multiplex ligation – dependent probe amplification ) PowerPoint Presentation
Download Presentation
MLPA ( Multiplex ligation – dependent probe amplification )

Loading in 2 Seconds...

  share
play fullscreen
1 / 39
raven-booth

MLPA ( Multiplex ligation – dependent probe amplification ) - PowerPoint PPT Presentation

380 Views
Download Presentation
MLPA ( Multiplex ligation – dependent probe amplification )
An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. MLPA(Multiplexligation – dependent probeamplification) Peter Böhm Nielsen

  2. Generelt analyseflow MLPA

  3. Anvendte metoder HRM & Sanger sekventering Allel 1 Allel 2 Allel 1 MLPA (Multiplex Ligation-dependent Probe Amplification) Allel 2

  4. Multiplex Ligation-Dependent Probe Amplification (MLPA) • MLPA er en teknik til kopitalsbestemmelse af specifikke sekvenser. Dette sker ved simultan binding af op til 45 prober, hvorefter det relative antal af bundne prober bestemmes. • Til udførelsen benyttes PCR amplifikation.

  5. MLPA Probehybridisering 1 Promoter Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 2 Promoter Exon 1 Intron 1 Intron 2 Exon 3

  6. MLPA (1)MultiplexLigationdependingProbeAmplification • Denaturering • Hybridisering • Ligering • Amplifikation • Fragment-analyse

  7. SALSA MLPA prober

  8. Hybridisering • MLPA probemixblandes med denatureretgenomisk DNA. • De to sammenhørende prober hybridiserestiltilstødende target sekvenser

  9. Ligering 3. Prober ligeressammenaf en thermostabilligase.

  10. Amplifikation • Et universelt primer par benyttestilamplifikationafalleligerede prober. Hvertamplifikatfrahver probe har en uniklængde (130 - 480 bp).

  11. Separation ogkvantiteringvedkapillærelektroforese Hver top er et amplifikatfra en specifik probe . Prøvernesammanlignes med en kontrolprøve. En forskelirelativtophøjde/areal indikerer en ændringikopitalaf den gældende probes target sekvens.

  12. MLPA

  13. MLPA

  14. MLPA

  15. MLPA

  16. MLPA

  17. Normal MLPA

  18. MLPA Deletion af exon 5-7

  19. MLPA Deletion af exon 3-16

  20. MLPA Duplikation af exon 13

  21. Hvad kan dette være ?

  22. Kan dette være rigtigt ? Det er ikke sandsynligt at ovenstående er deletioner, da proberne mellem de 2 exons har korrekt amplifikationsstatus.

  23. MLPAProbehybridisering (2) Stuffer sekvens OH P ACGTACGCACCT CCTTGATTTGGAC AGTTGGAACTAAACCTGTGCATGCGTGGATTTC Gen specifikke prober Kontroller Prober forsøges designet udenfor SNP’s

  24. MLPA prober - eksempler

  25. Anvendte metoder HRM & Sanger sekventering Allel 1 Allel 2 Allel 1 MLPA (Multiplex Ligation-dependent Probe Amplification) Allel 2

  26. Materialer og metoder CISH og FISH for HER-2 amplifikation (1)

  27. Materialer og metoder CISH og FISH for HER-2 amplifikation (2) Farshid.

  28. Materialer og metoder (Prøvemateriale (1))

  29. Materialer og metoder (Prøvemateriale (2))Hematoxylin og eosin-farvning (HE) Cancerceller kan ”fortyndes” i normale celler Hvad har det af betydning ?

  30. ResultaterNormal

  31. Resultater Amplificeret

  32. ResultaterMLPA vs. ISH

  33. Kvalitetssikring af resultatet Quantity-peaks Q-peaks: 64, 72, 76 & 82 – indikerer DNA mængde Uafhængig af ligering

  34. Kvalitetssikring af resultatet Denaturing-peaks TE TE+50mM NaCl TE+75mM NaCl D-peaks: 88, 92 & 96 – indikerer DNA kvalitet og ligerings-reaktion Afhængig af DNA &ligering D-prober er placeret tæt på CpG-island – kræver meget energi ved denatureringen

  35. Raw-data vurdering (sloping) God amplifikation Uensartet amplifikation Resultater med samme signal-niveau er bedst at sammenligne. Sloping er OK til et vist punkt, hvis normalisering kan udføres. Kan skyldes fordampning – test med 8µl vand.

  36. Rawdata vurdering

  37. ”Skuldre” Degradering af ligerede prober: Kør MLPA-analysen direkte efter fortynding i formamid