Download
short dispersed repeats n.
Skip this Video
Loading SlideShow in 5 Seconds..
Short Dispersed Repeats PowerPoint Presentation
Download Presentation
Short Dispersed Repeats

Short Dispersed Repeats

195 Views Download Presentation
Download Presentation

Short Dispersed Repeats

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Short Dispersed Repeats Kaleigh, mariam, Michael and Nicholas

  2. Start Associated Sequences in Enterobacteriophage Kaleigh hedges

  3. Ribosomal Binding Site (Shine-Dalgarno) http://themedicalbiochemistrypage.org/protein-synthesis.php#polya

  4. Is there a conserved sequence in Enterobacteriophagethat could help support translation initiation?Where are these repeats located? How far away from Gene start? What is the associated start codon? Do the sequences contain the Shine-Dalgarno sequence or is it nearby?

  5. Biobike / MEME

  6. Start Associated Sequences found in Enterobacterioophage

  7. Full Length ERIC Sequence Occurrence in Bacteriophage Michael Kiflezghi

  8. Question: Do Bacteriophage contain ERIC sequences? • Some Bacteriophage have potential (and in some cases realized) clinical applications (1) • Bacteriophage sometimes acquire host DNA (2, 3)

  9. Enterobacterial Repetitive IntergenicConsensus Sequences Wilson L A , and Sharp P M MolBiolEvol 2006;23:1156-1168

  10. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT

  11. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT

  12. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT

  13. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT

  14. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT

  15. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT

  16. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT

  17. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT

  18. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGAGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT CACTTACTTGTGTA AGCTCCCGGAGGAT Reverse TAGGAGGCCCTCGA

  19. PhAnToMe/BioBIKE: detecting the imperfect palindrome Window AATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGAGGATTCACAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATT CACTTACTTGTGTA AGCTCCCGGAGGAT TAGGAGGCCCTCGA SCORE = 5

  20. Preliminary Results Sequence found in Enterobacteria Phage Lambda

  21. Identification of Possible RNA Hairpin Sequences in sub-cluster B3Mycobacteriophages Mariam Sankoh

  22. How did I get here?

  23. Where did I go from there?

  24. Sample Input and Output

  25. Location Identification of Initial Sequences

  26. What’s Next? Palindromes within genes Improvements to Function • Decrease Function Runtime • Decrease Noise and Repeats • Allow User to Expand Window Size • Grab upstream and downstream sequence • Confirm Repeated Sequences • Function determination of Hairpin Sequences

  27. Identification of Small Regulatory RNA within Miniature Inverse-Repeat Elements of E. Coli K-12 Nicholas Rodriguez

  28. Questions? • Can new genes be created by transposable elements?

  29. Questions? • Can an organism make use of new genes in an advantageous way?

  30. Small Regulator y RNA • Short ~19-25bp • Palindromes • Regulate gene expression?

  31. Proposed Mechanism

  32. Identification of microRNA-Size, Small RNAs in Escherichia coli. Kang et al 2013 • Selectively Sequenced msRNA

  33. ERICS

  34. Methods • Searched for msRNAs in ERICs • Located Motifs from ERICSs in msRNA

  35. msRNA in ERICs

  36. Finding Motifs

  37. Motifs

  38. Where are the msRNA? • Near highly expressed genes • Hitching a ride?