1 / 34

Very Short Dispersed Repeats

Very Short Dispersed Repeats. Also, palindromes. What are they?. Short sequences (between 4 and 13-ish nucleotides) – one might even say they’re very short

isabel
Download Presentation

Very Short Dispersed Repeats

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Very Short Dispersed Repeats Also, palindromes

  2. What are they? • Short sequences (between 4 and 13-ish nucleotides) – one might even say they’re very short • Occur multiple times in the genome, at dispersed intervals (not repeated right next to each other) – “distributed or spread over a wide interval”

  3. It turns out that many of these very short dispersed sequences are palindromic – what does that mean? The sequence is read the same in the 5’  3’ direction as it is in the 3’  5’ direction.

  4. Occurrence of Highly Iterated Palindromes (HIP1) in Cyanobacteria

  5. Palindromic Sequence in Cyanobacteria5’-GCGATCGC-3’3’-CGCTAGCG-5’ But not all cyanobacteria have this sequence

  6. Blast SearchWhat is the purpose of HIP1? • ATGCATGATACGTAGCGATCGCCACCCGGGATTGCGATCGC • Match: GCGATCGC • What genes are nearby? • Prior research shows DAM methylase recognition and DNA profiling

  7. ThermosynechococcuselongatusBP1 &SynechococcusElongatus PCC 6301

  8. Prochlorococcus marinus mit9301 &Trichodesmium Erythraeum IMS101

  9. Results? • Hypothetical Proteins-highest peak in Themosynechococcus and Trichodesmium • Many metabolic proteins such as Ferredoxin, peptidase • Program to overlap nearby genes in different organisms

  10. References • Robinson, P. J., Cranenburgh, R. M., Head, I. M. and Robinson, N. J. (1997), HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies inEscherichia coli and Synechococcus PCC 7942. Molecular Microbiology, 24: 181–189.  • Robinson, P. J., Gupta, A., Bleasby, A., Whitton, B., Morby, AP. Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria • Moya, A. Delaye, L. Abundance and distribution of the highly iterated palindrome 1(HIP1) among prokaryotes Mob Genet Elements. 2011 Sep-Oct; 1(3) 159-168

  11. Occurrences of DNA uptake sequence from Haemophilusinfluenzae in other Pasteurellaceaebacteria By: Noha Mudhaffar

  12. AAGTGCGGT • 1516 (479 – 1001) • 1913428 • 0.3815231

  13. Highly Repeated Sequences

  14. Family: Pasteurellaceae

  15. Reference • Frequency and Distribution of DNA Uptake Signal Sequences in the Haemophilusinfluenzae Rd Genome. • Genomic Sequence of an Otitis Media Isolate of NontypeableHaemophilusinfluenzae: Comparative Study with H. influenzae Serotype d, Strain KW20. • Xu Z, Yue M, Zhou R, Jin Q, Fan Y, et al. (2011) Genomic Characterization of Haemophilusparasuis SH0165, a Highly Virulent Strain of Serovar 5 Prevalent in China. PLoS ONE 6(5): e19631. doi:10.1371/journal.pone.0019631. • DNA uptake signal sequences in naturally transformable bacteria.

  16. The Evolutionary Change of DNA Uptake Sequences in Neisseria meningitides.

  17. What are DNA Uptake Sequences (DUS)? • Neisseria sp. • Constitute ~1% of genome. • Homology • 5’GCCGTCTGAA’3 • Kingdom: Bacteria • Phylum: Proteobacteria • Class: Betaproteobacteria • Order: Neisseriales • Family: Neisseriaceae • Genus: Neisseria • Species:Neisseriameningitidis

  18. DNA Uptake Sequence • AT-DUS • AG-DUS

  19. A Closer Look

  20. DUS Inversion

  21. Phylogeny 16s rRNA DUS

  22. References • http://phil.cdc.gov/phil/details.asp?pid=2678 • Frye SA, Nilsen M, Tønjum T, Ambur OH. Dialects of the DNA uptake sequence in Neisseriaceae. PLoS Genet. 2013

  23. Six nucleotide palindromic sequences in Mycobacteriophage genomes What about them? That’s a great question. I’m glad you asked.

  24. How did we get here from Very Short Dispersed Repeats?A very short story. • Point A: “Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria.” • From there: what about palindromes in mycobacteriophages? ? 

  25. Avoidance of 6 nt palindromes in Mycobacteriophages Mycobacterial genomes generally do not avoid 6 palindrome sequence. Generally, this means that the viruses that infect them will not either. When two of the mycobacteriophage genomes were examined, they were found to avoid palindromes of size 6. “The sole exception is provided by the two M. tuberculosis phages D29 and L5, which strongly avoid palindromes of size 6.” (Rocha, et. al) 2001 L5 and D29 – Mycobacteriophage cluster A2

  26. Generated 186 random sequences of the same length of the average Mycobacteriophage genome (70627 nucleotides long) and same GC content (64%) and counted the number of occurrences of all 6 nucleotide palindromes in these randomly generated sequences.

  27. Occurrences of all 6 nucleotide palindromes over the actual genomes of Mycobacteriophages (or at least the 186 that BioBIKE knows)

  28. Which phages are outliers to the right? (>2000 occurrences) - these 15 ((Mycobacterium-phage-Cali 2485) – C, C1 (Mycobacterium-phage-Catera 2466) – C, C1 (Mycobacterium-phage-Alice 2437) – C, C1 (Mycobacterium-phage-LRRHood 2445) – C, C1 (Mycobacterium-phage-Rizal 2465) – C, C1 (Mycobacterium-phage-Nappy 2528) – C, C1 (Mycobacterium-phage-Ghost 2524) – C, C1 (Mycobacterium-phage-Drazdys 2506) – C, C1 (Mycobacterium-phage-ScottMcG 2480) – C, C1 (Mycobacterium-phage-Spud 2485) – C, C1 (Mycobacterium-phage-Sebata 2519) – C, C1 (Mycobacterium-phage-Pio 2505) - C, C1 (Mycobacterium-phage-Bxz1 2501) – C, C1 (Mycobacterium-phage-LinStu 2478) – C, C1 (Mycobacterium-phage-ET08 2466)) – C, C1 All of the cluster C1 phages in BioBIKE!

  29. What’re C1 cluster phages? • “Only two of these (Subclusters C1 and C2) correspond to phages with myoviral morphologies (with contractile tails)” • Okay, so they’re of the family Myoviridae. This means they are: generally lytic, and lack the necessary genes to become lysogenic. They have a contractile tail, and contracting the tail requires ATP. C cluster phage isolated by Michael Kiflezghi!

  30. Which sequences are occurring so frequently? GGCGCC GACGTC CGCGCG ACCGGT GTCGAC GCGCGC CCCGGG TGGCCA CAGCTG AGGCCT CGATCG CTGCAG TGCGCA Many of these are recognition sites for restriction enzymes. Significant? There’s a chance. Warrants more investigation? It seems likely.

  31. References and credit for pictures • phagesdb.org • Rocha, E., Danchin, A., & Viari, A. (2001). Evolutionary role of Restriction/Modification systems as revealed by comparative genome analysis. Genome Research, (11), 946-958. doi:10.1101/gr.153101Discussion of avoidance of palindromic sequences of length 4 and 6 and possible reasons for this avoidance in bacteria and bacteriophages. Mentions 2 mycobacteriophages that exhibit an avoidance for 6nt palindromes, L5 and D29. • Article Source: Expanding the Diversity of Mycobacteriophages: Insights into Genome Architecture and Evolution. Pope WH, Jacobs-Sera D, Russell DA, Peebles CL, Al-Atrache Z, et al. (2011) Expanding the Diversity of Mycobacteriophages: Insights into Genome Architecture and Evolution. PLoS ONE 6(1): e16329. doi: 10.1371/journal.pone.0016329 • cyanobacteria picture: http://www.um.edu.mt/__data/assets/image/0005/166604/oculatella2.jpg • mycobacteriophagepicture: http://openi.nlm.nih.gov/imgs/512/165/2884959/2884959_2711fig1.png • coral snake: http://upload.wikimedia.org/wikipedia/commons/8/8a/Coral_snake.jpg

More Related