1 / 21

Decoding the Genetic Blueprint: DNA, Transcription, Translation, and Protein Synthesis

Explore how DNA codes for proteins through transcription and translation processes. Discover the role of mRNA, tRNA, and ribosomes in protein synthesis, and learn how to decode the genetic information embedded in DNA to produce functional proteins.

merrill
Download Presentation

Decoding the Genetic Blueprint: DNA, Transcription, Translation, and Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Drill – Biology! 1) Where is DNA stored in eukaryotes? Prokaryotes? 2)Can DNA leave the nucleus? If not, how does the genetic code get to the rest of the cell? 3) What molecules make up the “code” in DNA? 4) What molecules make up the “backbone” of DNA? 5) Why does everyone except monozygotic (identical) twins look different?

  2. What does this mean? • Translate the following sentences into English: 1) La biología es el mejor tema (Biology is the best subject) 2) Digital Harbour tiene un olor raro (Digital Harbor has a weird smell) 3) Baltimore "La ciudad más grande en América" (Baltimore 'The Greatest City in America') • What would you need if you did not know Spanish to figure out these phrases? • What in your body (and in every living organism) needs to be decoded before it is useful?

  3. Questions to be answered today • How do we get from the bases found in DNA to amino acids? • How do we get from a bunch of amino acids to proteins?

  4. Transcription and Translation: An Overview (aka the Central Dogma) Transcription Translation

  5. Video: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related

  6. Protein Structure • Made up of amino acids • Polypeptide- string of amino acids • 20 amino acids are arranged in different orders to make a variety of proteins • Assembled on a ribosome So how do we make a complete protein?

  7. It starts with…TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG GGG ACU UGC UAU

  8. Transcription creates mRNA!!! • mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

  9. Transcription is done…what now? Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?

  10. Now we get to Translation!!! • Here we actually CODE for amino acids! • Second stage of protein production • mRNA is on a ribosome

  11. Translation • tRNA brings amino acids to the ribosome

  12. tRNA • Transfer RNA • Bound to one amino acid on one end • Anticodon on the other end complements mRNA codon

  13. tRNA Function • Amino acids must be in the correct order for the protein to function correctly • tRNA lines up amino acids using mRNA code

  14. The Steps: Pages 208 - 209 • 1) Initiation: mRNA, tRNA and the ribosome come together (AUG codes for the START – Methionine) • 2) Elongation: tRNA brings the specific amino acids together forming a chain (repeats over and over)

  15. The Steps • 3) Termination: Stop codon ends translation • 4) Disassembly: The ribosome falls apart and releases the protein

  16. Reading the DNA code • Every 3 DNA bases pairs with 3 mRNA bases • Every group of 3 mRNA bases encodes a single amino acid • Codon- coding triplet of mRNA bases

  17. Example problem: • DNA: ATGGCCTAAGGT • RNA: UACCGGAUUCCA (transcription) Refer to table 10-1 on page 207 to find the amino acids (Translation) • UAC = • CGG = • AUU = • CCA = Tyrosine Arginine Isoleucine Proline

  18. The Genetic Code

  19. ACGATACCCTGACGAGCGTTAGCTATCG UGC GGG ACUG UAU

  20. Class Work! • Complete the “Marshmallow Man” translation activity • When finished coding raise your hand to so I can check it and give you the materials! • Extra Credit – Create your own code using the letters ATGC. Then create a message and have another student attempt to translate it.

  21. Exit Pass: 1) What did the marshmallow man represent in the activity? 2) List the steps needed to create a protein (amino acid chain) 3) How many mRNA molecules are read as a codon? a) 2 b) 3 c) 4 d) 5

More Related