Question. Donner le ou les noms des auteurs des découvertes de biologie moléculaire suivantes - PowerPoint PPT Presentation

slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Question. Donner le ou les noms des auteurs des découvertes de biologie moléculaire suivantes PowerPoint Presentation
Download Presentation
Question. Donner le ou les noms des auteurs des découvertes de biologie moléculaire suivantes

play fullscreen
1 / 11
Question. Donner le ou les noms des auteurs des découvertes de biologie moléculaire suivantes
146 Views
Download Presentation
lyris
Download Presentation

Question. Donner le ou les noms des auteurs des découvertes de biologie moléculaire suivantes

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Exercice. Une solution pure d’ADN est chauffée. On mesure l’absorbance A (densité optique) à 260 nm à différente température. Les résultats suivants sont obtenus : • T°C 68 81 85 93 • A260 0,365 0,400 0,536 0,582 • Comment appelle-t-on ce phénomène ? • Que déduisez-vous des courbes suivantes en ce qui concerne les ADN 1, 2 et 3

  2. Question. Donner le ou les noms des auteurs des découvertes de biologie moléculaire suivantes • Elucidation de la structure chimique de l’acides désoxyribonucléique. • B. Identification des premiers ARN interférents. • C. Découverte du code génétique. • D. Mise en évidence du concept de l’ARN messager.

  3. Tous les éléments suivants sont nécessaires à la réplication de l’ADN sauf un, lequel? • Les désoxynucléotidestri-phosphates • Le magnésium • L’ADN polymérase • Facteur d’élongation • Une amorce d’ARN • F. La chaîne matrice

  4. Définir en une phrase les mots suivants : Anticodon Codon non sens Epingle à cheveux Bactériophage

  5. Soit le schéma ci-dessous représentant un tRNA et son anticodon. Quel sera l’acide aminé porté par ce tRNA ? 3’ 5’ A C C

  6. Exercice. Soit la séquence d’ARNm suivante : 5’AUGUCUGCUGUUAUUUGGUUUUUUGAAGAUAAAAAA Quelle est la conséquence sur le polypeptide codé par cet ARNm de l’insertion d’un C en 28ème position et de la délétion du 10ème nucléotide (par rapport à l’extrémité 5’) ?

  7. Carte de plasmide

  8. Analyse des produits de restriction : principes de l’électrophorèse : (-) Gros fragment logPM Petit fragment (+) Distance déterminée pour une bande étudiée Distance de migration

  9. Exercice : Carte de restriction. On considère un fragment d’ADN. Combien de bandes obtiendra t-on, après électrophorèse, si ce fragment de restriction est digéré par un enzyme de restriction ne le clivant qu’en un seul site ?

  10. Soit un ADN linéaire (2500 paire de bases) contenant un site de restriction unique pour chacun de ces enzymes : SmaI, BglII, et SacI. Après digestion enzymatique, les profils électrophorétiques sont les suivants : • ADN + SmaI = 2 bandes (700 et 1800 pb) • ADN + SacI = 2 bandes (250 et 2250 pb) • ADN + SacI + SmaI = 3 bandes (250, 700 et 1550 pb) • ADN + BglII= 2 bandes (1000 et 1500 pb) • ADN + BglII+ SmaI = 3 bandes (300, 700 et 1500 pb) • En déduire la carte de restriction de cet ADN.