530 likes | 682 Views
LA NUOVA BIOLOGIA PROSPETTIVE E IMPLICAZIONI ETICHE. Uno sguardo alla nuova biologia Alessandro Quattrone. Colture cellulari. Affollamento macromolecolare. L’interno delle cellule è un ambiente molto denso ed affollato. Livelli di osservazione nelle cellule.
E N D
LA NUOVA BIOLOGIA PROSPETTIVE E IMPLICAZIONI ETICHE
Uno sguardo alla nuova biologia Alessandro Quattrone
Affollamento macromolecolare L’interno delle cellule è un ambiente molto denso ed affollato
Il DNA (DeoxyriboNucleic Acid) B-type A-type Z-type
Le quattro “basi” del DNA A G C T PYRIMIDINES PURINES
Le sequenze di DNA CAACCTTTGGGATGTGTGCATGGTGGCAAGGGGCTGACTGATATGAGATTACTTCTTTTA AGGGAAATTGTCATTAATGAGTCAAGAAACTGCTCATTTATGATAATTAGCACCATGGAG CCTCAGGTGTCAAATGGTCCGACATCCAATACAAGCAATGGACCCTCCAGCAACAACAGA AACTGTCCTTCTCCCATGCAAACAGGGGCAACCACAGATGACAGCAAAACCAACCTCATC GTCAACTATTTACCCCAGAATATGACCCAAGAAGAATTCAGGAGTCTCTTCGGGAGCATT GGTGAAATAGAATCCTGCAAACTTGTGAGAGACAAAATTACAGGACAGAGTTTAGGGTAT GGATTTGTTAACTATATTGATCCAAAGGATGCAGAGAAAGCCATCAACACTTTAAATGGA CTCAGACTCCAGACCAAAACCATAAAGGTCTCATATGCCCGTCCGAGCTCTGCCTCAATC AGGGATGCTAACCTCTATGTTAGCGGCCTTCCCAAAACCATGACCCAGAAGGAACTGGAG CAACTTTTCTCGCAATACGGCCGTATCATCACCTCACGAATCCTGGTTGATCAAGTCACA GGAGTGTCCAGAGGGGTGGGATTCATCCGCTTTGATAAGAGGATTGAGGCAGAAGAAGCC ATCAAAGGGCTGAATGGCCAGAAGCCCAGCGGTGCTACGGAACCGATTACTGTGAAGTTT GCCAACAACCCCAGCCAGAAGTCCAGCCAGGCCCTGCTCTCCCAGCTCTACCAGTCCCCC AACCGGCGCTACCCAGGTCCACTTCACCACCAGGCTCAGAGGTTCAGGCTGGACAATTTG CTTAATATGGCCTATGGCGTAAAGAGGTTCTCCCCAATTACCATTGATGGAATGACAAGC CTTGTGGGAATGAACATCCCTGGTCACACAGGAACTGGGTGGTGCATCTTTGTCTACAAC CTGTCCCCCGATTCCGATGAGAGTGTCCTCTGGCAGCTCTTTGGCCCCTTTGGAGCAGTG AACAACGTAAAGGTGATTCGTGACTTCAACACCAACAAGTGCAAGGGATTCGGCTTTGTC ACCATGACCAACTATGATGAGGCGGCCATGGCCATCGCCAGCCTCAACGGGTACCGCCTG GGAGACAGAGTGTTGCAAGTTTCCTTTAAAACCAACAAAGCCCACAAGTCCTGAATTTCC CATTCTTACTTACTAAAATATATATAGAAATATATACGAACAAAACACACGCGCGCACAC ACACACATACACGAAAGAGAGAGAAACAAACTTTTCAAGGCTTATATTCAACCATGGACT TTATAAGCCAGTGTTGCCTAAGTATTAAAACATTGGATTATCCTGAGGTGTACCAGGAAA GGATTTTATAATGCTTAGAAAAAAAGAAAAAAAAA
Flusso dell’informazione: il Dogma Centrale need a code
July 25, 2005 Issue of Science • “The great, hard questions that point to critical gaps in our scientific knowledge” • What Is the Universe Made Of? • Can the Laws of Physics be United? • What Is the Biological Basis of Consciousness? • Why Do Humans Have So Few Genes? • What Controls Organ Regeneration? • How Can a Skin Cell Become a Nerve Cell? • How Does a Single Somatic Cell Become a Whole Plant? • What Genetic Changes Made Us Uniquely Human?
Il flusso duale dell’informazione nella vita development organism (mortal) germinal cell line(immortal)
Il flusso difettivo: malattie multigenic and multifactorial diseases(“complex”) single gene diseases (“genetic”)
Geni e malattie • malattiea gene singolo • una sola lesionemolecolare • stessamutazione • stesso gene ma mutazioni diverse • malattiecomplesse • piùlesionimolecolaricopresenti: • in genidifferenti • di “peso differente” • in combinationidifferenti
La visione dall’alto con dettaglio 21 novembre 1783, Pilâtre de Rozier e marchese d'Arlandes
Gli spazi “omici” metaboloma (piccole molecole) proteoma (proteine) trascrittoma (mRNA) genoma (DNA)
Il genoma umano, alla fine Nature 431, 931 - 945 (21 October 2004) Finishing the euchromatic sequence of the human genome International Human Genome Sequencing Consortium The sequence of the human genome encodes the genetic instructions for human physiology, as well as rich information about human evolution. In 2001, the International Human Genome Sequencing Consortium reported a draft sequence of the euchromatic portion of the human genome. Since then, the international collaboration has worked to convert this draft into a genome sequence with high accuracy and nearly complete coverage. Here, we report the result of this finishing process. The current genome sequence (Build 35) contains 2.85 billion nucleotides interrupted by only 341 gaps. It covers 99% of the euchromatic genome and is accurate to an error rate of 1 event per 100,000 bases. Many of the remaining euchromatic gaps are associated with segmental duplications and will require focused work with new methods. The near-complete sequence, the first for a vertebrate, greatly improves the precision of biological analyses of the human genome including studies of gene number, birth and death. Notably, the human genome seems to encode only 20,000−25,000 protein-coding genes.The genome sequence reported here should serve as a firm foundation for biomedical research in the decades ahead.
Convergence Genome Sequencing: read 1995 First bacterial genome 2001 First metazoan genome 2003 Human genome 2006 30 vertebrate genomes 2008 Individual human genomes Nanobiotecnology: measure new biology 1992 Photolitography for microarrays 1998 Spotting for microarrays 2000 Mass Spectrometry for proteins 2005 Microfluidics and nanobiosensors DNA manipulation and synthesis: perturb & reproduce 1979 Recombinant DNA In bacteria 1989 Recombinant DNA In mice 2005 Synthetic Biology methods 2008 Synthetic DNA breakthrough Mining and Modelling Algorithms: interpret & predict 1940 Models of excitable cell behaviour 1995 Sequence annotation algorithms 1998 Ontologies in Biology 2002 Prediction phenotype models
Convergence Genome Sequencing: Systems Nanobiotecnology: Systems/Synthetic new biology DNA manipulation and synthesis: Synthetic Mining and Modelling Algorithms: Semantic
Convergence Genome Sequencing sequence/disease association Clinical Data Recording
Convergence Nanobiotecnology predictive medicine Clinical Data Recording Mining and Modelling Algorithms
Convergence synthetic biology DNA manipulation and synthesis Mining and Modelling Algorithms
Sequenziamento individuale • 2003: TDG • the “thousand dollar genome” • 2007: Solexa • sequenziamentomassivo • all’1% del costoattuale
con dettaglio La visione dall’alto
I business della genomica farmacogenomica nutrigenomica tossicogenomica • Diete e supplementi su base individuale • Industria alimentare • Industria dei diagnostici • Identificazione su base individuale dei composti pericolosi • Misure atte ad evitare sostanze tossiche nell’ambiente domestico e di lavoro • Industria dei diagnostici • Industria chimica • Prescrizioni di farmaci su base individuale, farmaci meno tossici e più efficaci • Farmaci più selettivi • Industria farmaceutica • Industria biotecnologica una vita più lunga e più in salute, invecchiamento rallentato, decremento del tasso di incidenza di malattie e cure più efficaci
A “synthetic” world Thomas Knight, Jr: from ARPANET to the new biology through artificial intelligence 3
Biobricks • Composable set of genetic building blocks (genes, short pieces of DNA). • More than 2,000 today • Consist of sensors, actuators, input and output devices, and regulatory elements. • Each BioBrick can send and receive standard biochemical signals and be cut and pasted into a linear sequence of other BioBricks
P S + P S P S
Biobrick Assembly RNA-Related Protein Targeting FLAG cMyc Stops Myri HA NLS SV40 pA GST Kozak Long ½ life Kozak Short ½ life ... IRES2 ... GFP CMV RFP UAS mCMV RLuc ... Tre mCMV ... Done in 5 assemblies! Your Protein of Interest 3