1 / 23

Unlocking the mystery of DNA

Unlocking the mystery of DNA. Prior to the 1950’s. What we knew: Inherited characteristics are determined by genes Genes are passes from one generation to the next Genes are part of a chromosome Chromosomes are made of protein and DNA. Cell division and DNA replication. Cells divide.

kathleendsmith
Download Presentation

Unlocking the mystery of DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Unlocking the mystery of DNA

  2. Prior to the 1950’s What we knew: • Inherited characteristics are determined by genes • Genes are passes from one generation to the next • Genes are part of a chromosome • Chromosomes are made of protein and DNA

  3. Cell division and DNA replication • Cells divide • Growth, Repair, Replacement Before cells divide, they have to double cell structures, organelles and their genetic information

  4. DNA replication – Mitosis & Meiosis

  5. But… What did DNA look like, and how did it replicate itself?

  6. Discovering the structure of DNA Rosalind Franklin (1920-1958) • King’s College, London • Made significant advances in x- ray diffraction techniques with DNA • Her images suggested that DNA had a spiral shape • One of her DNA images

  7. Discovering the structure of DNA Maurice Wilkins – (1916-2004) • King’s College, London • Also did X-ray diffraction studies of DNA • Worked with Rosalind Franklin • Shared information with Watson and Crick

  8. Discovering the structure of DNA Erwin Chargaff – (1905-2002) • Columbia University, NY • Investigated the composition of DNA • His findings by 1950 strongly suggested the base-pairings of A-T & G-C • Met with Watson and Crick in 1952 and shared his findings • “Chargaff’s rule” A = T & C = G

  9. Discovering the structure of DNA James Watson (1928) and Francis Crick (1916-2004) • Worked together at Cavendish Laboratory in Cambridge to determine the structure of DNA • Used work from Franklin, Wilkins, and Chargaff to determine the double helix shape • Watson, Crick, and Wilkins were awarded the Nobel Prize • Rosalind Franklin passed away (1958) before the Nobel Prize was awarded in 1962

  10. Discovering the structure of DNA • DNA = Deoxyribose nucleic acid • Present in all living cells • Contains all the information • Nucleotides: • a subunit that consists of: • a sugar (deoxyribose) • a phosphate • and one nitrogen base – 4 different bases • Adenine (A) and Thymine (T) • Guanine (G) and Cytosine (C)

  11. DNA – What does my code look like? Computer Code: 10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…

  12. Practice DNA Base Pairs

  13. DNA replication – helix unzips

  14. DNA replication – helix unzips

  15. DNA replication – two strands are separated

  16. DNA replication – each side is now a template

  17. DNA replication – two identical strands of DNA Original DNA strands

  18. DNA replication Newly assembled DNA strands

  19. DNA replication Semi-conservative replication

  20. Build a DNA molecule – you try it! http://learn.genetics.utah.edu/content/begin/dna/builddna/

  21. DNA replication- you try it! http://pbs.org/wgbh/aso/tryit/dna/shockwave.html

More Related