mystery of the l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Mystery of the PowerPoint Presentation
Download Presentation
Mystery of the

Loading in 2 Seconds...

play fullscreen
1 / 33

Mystery of the - PowerPoint PPT Presentation


  • 106 Views
  • Uploaded on

Mystery of the. Matching Marks. part 2. Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES : What do you see in the chimp chromosomes (on the right ) that is DIFFERENT from the human chromosomes (on the left )?.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Mystery of the' - liang


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
mystery of the

Mystery of the

Matching Marks

part 2

let s look at our two sets of chromosomes again side by side

Let’s look at our two sets of chromosomes again, side-by-side.

This time, Focus on their DIFFERENCES:

What do you see in the

chimp chromosomes (on the right) that is DIFFERENT from

the human chromosomes (on the left)?

good eyes chimp s 2 is shorter than our 2 chimp has an extra unmatched chromosome

GOOD EYES!- Chimp’s #2 is shorter than our #2-Chimp has an extra unmatched chromosome

What could have happenedto cause those differences?

Let’s take a closer look

at those chromosomes…

slide5

“Missing” part

“Extra” in chimps

ANY IDEAS that

might EXPLAIN the “missing” part of the chimp’s #2 chromosome,AND the chimp’s “extra”chromosome?

slide6

Maybe the chimp’s“extra” chromosomewas once part of itsshort #2.

Could the “extra”chromosome match the upper part ofour #2?

LET’S TRY IT…

slide7

Nope!They don’t seemto match.What else couldwe try?

Turn the “extra” oneupside down?!

Let’s try it…

slide9

WOW !IT WORKED! They DO MATCH!

NOW, the next question:“How could this happen?”

  • Was there ONE #2 in ourcommon ancestor, that splitto make TWO in chimps, OR
  • Were there TWO shortchromosomes in our ancestor that
  • fused (joined) to make ONE in humans?
slide10

We DO have a PROBLEM:

“How did this difference happen?”

And, we have two hypotheses(possible explanations):

1. Onesplit to make two, OR

2. Twofused (joined) to make one

Let’s try the second one (fusion). How can we TEST that hypothesis?

slide11

We could look for evidence offusion in the middle of our#2 chromosome…

But, what kind of evidence can we look for?

Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…

chromosome parts
CHROMOSOME PARTS

HeadTelomere

All Chromosomes have telomeres at bothends(like shoelace aglets!)

Centromere

TailTelomere

Telomeres have a special DNA sequence…

ttagggttagggttagggttagggttagggttaggg…

||||||||||||||||||||||||||||||||||||

aatcccaatcccaatcccaatcccaatcccaatccc…

slide13

Did you notice the repeated sequence: ttaggg?

HeadTelomere

DNA Sequence for Telomeres:

ttagggttagggttaggg…

||||||||||||||||||

aatcccaatcccaatccc…

NOTICE:

Tandem Repeats in Telomeres:

ttagggttagggttaggg…

||||||||||||||||||

aatcccaatcccaatccc…

Centromere

TailTelomere

“ttaggg” is repeated 800-1600 times in each Telomere

slide14

Here’s another view ofa chromosome,showing the telomeresuntwisted, and their typicalDNA sequence

It also shows that theupper (shorter) armabove the centromereis called the “p-arm”, andthe lower (longer) arm iscalled the “q-arm”

slide15

TELOMERE DNA CLOSE-UP

Here are ends of the uppertelomeres of thechimp’s “short”chromosome (left)…

and its “extra”chromosome (right)

Short #2

“Extra”

slide16

NOTICE!

When we turn the “extra”chromosome upside-down,and try to connect it to the“short” chromosome, it onlyFITS one way (left)…

They do NOT fitwhen one telomere istwisted 180o (right)

slide17

FURTHERMORE…When we lay the fusion area on its side,we can see more clearly how the DNA sequencechanges at the fusion point.

Reading the top strand only, see:T T A G G G C C C T A A

slide18

THAT’S WHAT YOU WILL BE LOOKING FORWhen you are searching the DNA for theFusion Point, you will be lookingat only one strand of DNA (since the “lower” strand is the predictablecomplement of the “upper” strand).Look for something like this:

…ttagggttagggttagggccctaaccctaaccctaa…

Read this like lines of text in a book…Do you see where the multiple g’s (and no c’s) END,and multiple c’s (and no g’s) BEGIN?

slide19

What would this point be called?(where multiple g’s stop, andmultiple c’s begin)

This would be the FUSION POINTRaise your hand when you see that point in this actual DNA strand below:

On which line does the change happen?

slide20

Maybe this will show itmore clearly:

THERE’S the FUSION POINT !

GOT THE PICTURE?

slide21

NOW…WHERE should we LOOKfor theFUSION POINT?

2a

YES!Right in the MIDDLEof our chromosome #2,where the two matchingchimp chromosomesoverlap !

2b

slide22

This would be BELOW theCENTROMERE, in the “q-arm” of the chromosome,in the region known as“2q13”,shown in red.

2a

2b

(Can you figure out wherethe number “2q13”comes from?)

slide23

(OPTIONAL)

For “2q13”…

2 = chromosome #2

q = the q-arm

1 = region 1 of that arm

3 = sub-part 3 of that region

2a

2b

slide24

So, where can we see the DNAfrom this region of our#2 chromosome

to examine?

I have gone to an online DNA databaseand printed out the DNA in that region.

You could do this yourself, but, to savetime, I’ve done that for you…

slide25

This 2q13 region

gives us 52 pages of DNA!

This is what a page looks like…

On this page, there

are 57 lines,

each line with60 bases (letters),and that gives us…3,420 bases per page!

slide26

If these 52 pageswere attachedend-to-end,they would stretchabout 14 meters(16 yards) aroundyour room!AND…

If ALL the DNA from ourENTIRE #2 chromosomewas printed out like this,it would stretch about16 km (10 miles)!

slide27

By the way…

Each number on the left edge equals the

number of the first base (letter)on that line.

And, a space has been inserted

after every 10th base (letter)to make counting easier.

slide28

You may notice

when you are

searching, that

the “ttaggg” pattern

is not perfect!

An occasional “c”

slips in here and there,

and you will see other

minor “glitches.”

WHY?

If you said

“MUTATIONS,”

you would be right.

slide29

NOW, it’s YOUR turn!

You get to SEARCH those 52 pages!

Are you ready???

Just kidding!Actually, you will formteams of 3-4, andeach team gets thesame 4 pages (from the “2q13” region)

slide30

One of those 4 pagesshould have the“Fusion Area”

Each person looks forthat “Fusion Area” ona different page.

When one of you findsit, show your partners.

Discuss your discovery with your partners,

and answer the questions

on your “SEARCH” worksheet

slide31

RECAP

PROBLEM: How did our #2 chromosomecome to look identical to two chromosomesin chimpanzees”

Chimp Us

HYPOTHESIS: our #2 chromosome was formed by the fusion oftwo chromosomes in an ancestor, after chimps branched off.

Fusion?

<--Common Ancestor

TEST: Look for fusionevidencein the form of telomere DNAin the middle of our #2chromosome

PREDICTIONS: If hypothesis is true, we

should find two telomeres there;If NOT true, should be NO telomeres there.

slide33

Students get into teams now,and pick up team folder with 4 DNA pages per team, and1 worksheet per student.

Go to MMM2 for followup slides, to show after teams find fusion points, or to show optional DNA models of telomeres.