Unlocking the mystery of DNA
Download
1 / 21

Unlocking the mystery of DNA - PowerPoint PPT Presentation


  • 157 Views
  • Updated On :

Unlocking the mystery of DNA. Prior to the 1950’s. What we knew: Inherited characteristics are determined by genes Genes are passes from one generation to the next Genes are part of a chromosome Chromosomes are made of protein and DNA. Cell division and DNA replication. Cells divide.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Unlocking the mystery of DNA' - oihane


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Slide2 l.jpg

Prior to the 1950’s

What we knew:

Inherited characteristics are determined by genes

Genes are passes from one generation to the next

Genes are part of a chromosome

Chromosomes are made of protein and DNA


Slide3 l.jpg

Cell division and DNA replication

  • Cells divide

  • Growth, Repair, Replacement

  • Before cells divide, they have to double cell

  • structures, organelles and their genetic

  • information



Slide5 l.jpg

But…

What did DNA

look like, and how did it replicate itself?


Slide6 l.jpg

Discovering the structure of DNA

  • Rosalind Franklin (1920-1958)

  • King’s College, London

  • Made significant advances in

  • x- ray diffraction techniques

  • with DNA

  • Her images suggested that

  • DNA had a spiral shape

  • One of her DNA images


Slide7 l.jpg

Discovering the structure of DNA

  • Maurice Wilkins – (1916-2004)

  • King’s College, London

  • Also did X-ray diffraction studies

  • of DNA

  • Worked with Rosalind Franklin

  • Shared information with Watson and Crick


Slide8 l.jpg

Discovering the structure of DNA

  • Erwin Chargaff – (1905-2002)

  • Columbia University, NY

  • Investigated the composition of DNA

  • His findings by 1950 strongly

  • suggested the base-pairings

  • of A-T & G-C

  • Met with Watson and Crick in

  • 1952 and shared his findings

  • “Chargaff’s rule” A = T & C = G


Slide9 l.jpg

Discovering the structure of DNA

  • James Watson (1928) and Francis Crick (1916-2004)

  • Worked together at Cavendish Laboratory in Cambridge

  • to determine the structure of DNA

  • Used work from Franklin, Wilkins, and Chargaff to

  • determine the double helix shape

  • Watson, Crick, and Wilkins

  • were awarded the Nobel Prize

  • Rosalind Franklin passed away

  • (1958) before the Nobel Prize

  • was awarded in 1962


Slide10 l.jpg

Discovering the structure of DNA

  • DNA = Deoxyribose nucleic acid

    • Present in all living cells

    • Contains all the information

  • Nucleotides:

  • a subunit that consists of:

    • a sugar (deoxyribose)

    • a phosphate

    • and one nitrogen base – 4 different bases

      • Adenine (A) and Thymine (T)

      • Guanine (G) and Cytosine (C)


Slide11 l.jpg

DNA – What does my code look like?

Computer Code:

10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100

DNA Code:

ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…


Slide12 l.jpg

Practice DNA Base Pairs

G A T T A C A

C T A A T G T







Slide18 l.jpg

DNA replication

Newly assembled DNA strands


Slide19 l.jpg

DNA replication

Semi-conservative replication