slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Unlocking the mystery of DNA PowerPoint Presentation
Download Presentation
Unlocking the mystery of DNA

Loading in 2 Seconds...

  share
play fullscreen
1 / 21
oihane

Unlocking the mystery of DNA - PowerPoint PPT Presentation

209 Views
Download Presentation
Unlocking the mystery of DNA
An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Unlocking the mystery of DNA

  2. Prior to the 1950’s What we knew: Inherited characteristics are determined by genes Genes are passes from one generation to the next Genes are part of a chromosome Chromosomes are made of protein and DNA

  3. Cell division and DNA replication • Cells divide • Growth, Repair, Replacement • Before cells divide, they have to double cell • structures, organelles and their genetic • information

  4. DNA replication – Mitosis & Meiosis

  5. But… What did DNA look like, and how did it replicate itself?

  6. Discovering the structure of DNA • Rosalind Franklin (1920-1958) • King’s College, London • Made significant advances in • x- ray diffraction techniques • with DNA • Her images suggested that • DNA had a spiral shape • One of her DNA images

  7. Discovering the structure of DNA • Maurice Wilkins – (1916-2004) • King’s College, London • Also did X-ray diffraction studies • of DNA • Worked with Rosalind Franklin • Shared information with Watson and Crick

  8. Discovering the structure of DNA • Erwin Chargaff – (1905-2002) • Columbia University, NY • Investigated the composition of DNA • His findings by 1950 strongly • suggested the base-pairings • of A-T & G-C • Met with Watson and Crick in • 1952 and shared his findings • “Chargaff’s rule” A = T & C = G

  9. Discovering the structure of DNA • James Watson (1928) and Francis Crick (1916-2004) • Worked together at Cavendish Laboratory in Cambridge • to determine the structure of DNA • Used work from Franklin, Wilkins, and Chargaff to • determine the double helix shape • Watson, Crick, and Wilkins • were awarded the Nobel Prize • Rosalind Franklin passed away • (1958) before the Nobel Prize • was awarded in 1962

  10. Discovering the structure of DNA • DNA = Deoxyribose nucleic acid • Present in all living cells • Contains all the information • Nucleotides: • a subunit that consists of: • a sugar (deoxyribose) • a phosphate • and one nitrogen base – 4 different bases • Adenine (A) and Thymine (T) • Guanine (G) and Cytosine (C)

  11. DNA – What does my code look like? Computer Code: 10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…

  12. Practice DNA Base Pairs G A T T A C A C T A A T G T

  13. DNA replication – helix unzips

  14. DNA replication – helix unzips

  15. DNA replication – two strands are separated

  16. DNA replication – each side is now a template

  17. DNA replication – two identical strands of DNA Original DNA strands

  18. DNA replication Newly assembled DNA strands

  19. DNA replication Semi-conservative replication

  20. Build a DNA molecule – you try it!

  21. DNA replication- you try it!