jenny
Uploaded by
33 SLIDES
442 VIEWS
330LIKES

Biotechnology

DESCRIPTION

Biotechnology. DNA Technology. What is Biotech. Biobyte – what is biotech. Restriction enzymes. Bacteria fight invading viruses with Restriction Enzymes. Degrade phage DNA by cleaving (cutting) it into fragments. .

1 / 33

Download Presentation

Biotechnology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Biotechnology DNA Technology

  2. What is Biotech Biobyte – what is biotech

  3. Restriction enzymes Bacteria fight invading viruses with Restriction Enzymes. Degrade phage DNA by cleaving (cutting) it into fragments.

  4. Why doesn’t a restriction enzyme cut the DNA of the bacterial cell that makes it? Methylation protects the bacteria’s own DNA from being cleaved.

  5. Example For example, the enzyme EcoRI cuts DNA only where it encounters the following paired sequence in the DNA double helix:

  6. You try it! TCGAATTCTAGGCTAACCGGAGASTTCACCGTACGAATTCCTTCAGCAATTCAGACGTA (video clip – human physiology restriction enzymes)

  7. Restriction enzyme flash

  8. Gel Electrophoresis When DNA is treated with restriction enzymes, the DNA is cut into fragments of various sizes. These fragments can be separated in a gel on the bases on their electric charge and size.

  9. Gel Electrophoresis Flash video

  10. DNA fingerprinting • DNA-based technique for identifying individuals. • Uses restriction analysis and electrophoresis.

  11. Crime Scene and DNA fingerprinting

  12. DNA Fingerprinting DNA fingerprinting methods require at least 1 µg of DNA, or the DNA content of about 100,000 human cells.

  13. polymerase chain reaction (PCR) Can multiply (“amplify”) the DNA of interest from even a single cell, producing in a few hours the necessary 1 µg for restriction digestion and electrophoresis.

  14. PCR 1) Double-stranded fragments of DNA are separated into single strands by heating (denatured).

  15. PCR 2) ADD: a) A short primer b) along with the Bases (A,C,T,G) c) DNA polymerase to catalyze the production of complementary new strands. (video polymerase chain reaction animated)

  16. DNA Barcode

  17. DNA BARCODE Identify each species with a “DNA barcode” He chose is the cytochromeoxidase gene. Mutates readily, there should be many differences between species. Present in most cells Reasonable in size (650-750 base pairs)

  18. Why DNA barcode? advance biological research on evolution to track species diversity help identify new species detect undesirable microbes or bioterrorism agents

  19. Make your own transgenic plant

More Related