favian
Uploaded by
44 SLIDES
520 VIEWS
440LIKES

Chapter 11

DESCRIPTION

Chapter 11. 0. How Genes Are Controlled. Chapter 12. 0. DNA Technology. How can Mutations affect different generations? 1- I take a new experimental pill that changes the DNA in my skin cells to make me permanently tan. 2- I go to gym to get huge muscles.

1 / 44

Download Presentation

Chapter 11

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 11 0 How Genes Are Controlled

  2. Chapter 12 0 DNA Technology

  3. How can Mutations affect different generations? 1- I take a new experimental pill that changes the DNA in my skin cells to make me permanently tan. 2- I go to gym to get huge muscles. 3- I smoke cigarettes and get lung cancer. 4- I expose myself to gamma rays to become the Hulk.

  4. Bacterial DNA Human Insulin Gene ENZYME Insulin producing Bacteria Transformation • The human gene for insulin is inserted into bacteria • Because the genetic code is universal, the human gene can be transcribed and translated by the bacteria, thereby creating large amounts of insulin.

  5. Plant Clones Single cell Cell division in culture Root cells in growth medium Root of carrot plant Figure 11.12-3

  6. Single cell Young plant Cell division in culture Root cells in growth medium Root of carrot plant Figure 11.12-4

  7. Single cell Young plant Adult plant Cell division in culture Root cells in growth medium Root of carrot plant Figure 11.12-5

  8. The somatic cells of a single plant can be used to produce hundreds of thousands of clones. • Plant cloning • Demonstrates that cell differentiation in plants does not cause irreversible changes in the DNA • Is now used extensively in agriculture

  9. Reproductive Cloning of Animals • Nuclear transplantation • Involves replacing nuclei of egg cells with nuclei from differentiated cells • Has been used to clone a variety of animals • Success/Efficiency rate NOT good

  10. In 1997, Scottish researchers produced Dolly, a sheep, by replacing the nucleus of an egg cell with the nucleus of an adult somatic cell in a procedure called reproductive cloning, because it results in the birth of a new animal.

  11. Remove nucleus from egg cell Figure 11.13-1

  12. Donor cell Remove nucleus from egg cell Add somatic cell from adult donor Figure 11.13-2

  13. Donor cell Nucleus from donor cell Remove nucleus from egg cell Add somatic cell from adult donor Grow in culture to produce an early embryo Figure 11.13-3

  14. Reproductive cloning Donor cell Nucleus from donor cell Clone of donor is born Implant embryo in surrogate mother Remove nucleus from egg cell Add somatic cell from adult donor Grow in culture to produce an early embryo Figure 11.13-4

  15. Figure 11.13a

  16. Human Cloning • Cloning of animals • Has heightened speculation about human cloning • Is very difficult and inefficient • Critics raise practical and ethical objections to human cloning.

  17. There is no better way to understand the human genome Ability to produce “superhumans” Will all but cease the production of lab animals Medicinal methods will be thrusted into a new era Further understanding of our past (evolution) Organ transplant waiting lists will be no more Cloning Pros:

  18. Cloning Cons: • Humans are sentient beings, they are not made to be specimens. They are of free will • Ability to produce “Superhumans” • Countries could clone armies • If humans can be cloned, it makes them property, which can be sold. Inhumane • If cloning is relied upon for reproduction and we lose the ability to clone, everyone will have the same genotype and to reproduce would be a sick twist of inbreeding. • If everyone has the same genotype, a disease that is fatal for that genotype wipes out the human race

  19. Cloning does NOT take into account environmental traits or factors.

  20. The expression of some genotypes depends on specific environments. Himalayan Rabbit

  21. Gel Electrophoresis • Gel electrophoresis is a technique used to separate DNA into genes based on physical characteristics such as size.

  22. Restriction Enzyme • Cuts DNA at specific sites—depending on enzyme. • EcoR1 cuts DNA GAATTC • PovII cuts DNA CAGCTG • SmaI cuts DNA CCCGGG • StuI cuts DNA AGGCCT • Alul cuts DNA AGCT

  23. Use Enzyme Fournier1 which cuts CCGG ATCGTCGAACTGGGATCCGGTAAAGCTTTAAGGCCTTACGTTCCGGGAAGGTTCCGGATTAAGGCCTTAAGGTTTCCGATCGATCGATTCGATCCGGATATCGGTAATTCGAATTCGTGTCATCGTTACGCTTGCCGGAATTTCCGTATCGCCGGTTAATCTGAGACTACGGAGCATCGTAGTC Segments are 18, 26, 11, 40, 41, 17 and 31. So, in order, you get banding at: 11, 17, 18, 26, 31, 40, 41

  24. Mixture of DNA fragments of different sizes Band of longest (slowest) fragments Power source Gel Band of shortest (fastest) fragments Completed gel Figure 12.17-3

  25. GMO- genetically modified organism Organisms altered by genetic engineering. -genetic material changed by other than random natural breeding. -gene transfer-moving a gene from one organism to another. -these require skill and knowledge to be carried out properly

  26. Agriculture -food processors affected by genetic engineering. -shelf-life, storage, food-handling; extended and simplified. -help resist spoilage. -plants transformed-insect,disease, and herbicide resistant.-animals treated engineered hormones-produce more milk, leaner meat.

  27. Advocates of a cautious approach are concerned that: • Crops carrying genes from other species might harm the environment • GM foods could be hazardous to human health • Transgenic plants might pass their genes to close relatives in nearby wild areas

  28. In 2000, negotiators from 130 countries (including the United States) agreed on a Biosafety Protocol that: • Requires exporters to identify GM organisms present in bulk food shipments

  29. Genetic Ethics • Solving Crimes • Increase/Make better crops & food • Increased info : health, admittance • Cloning

  30. Medicinal Studies • Control Group • Comparative results • Cost • Ethics • Help 1 now or Save all later?

  31. SCID is a fatal inherited disease caused by a single defective gene that prevents the development of the immune system. • SCID patients quickly die unless treated with: • A bone marrow transplant or • Gene therapy • Since the year 2000, gene therapy has: • Cured 22 children with inborn SCID but • Unfortunately, caused four of the patients to develop leukemia, killing one of these children

  32. Ethical Questions Raised by DNA Technology • DNA technology raises legal and ethical questions—few of which have clear answers. • Should genetically engineered human growth hormone be used to stimulate growth in HGH-deficient children? • Do we have any right to alter an organism’s genes—or to create new organisms? • Should we try to eliminate genetic defects in our children and their descendants? • Should people use mail-in kits that can tell healthy people their relative risk of developing various diseases?

  33. Reproductive cloning Donor cell Nucleus from donor cell Clone of donor is born Implant embryo in surrogate mother Therapeutic cloning Remove nucleus from egg cell Add somatic cell from adult donor Grow in culture to produce an early embryo Remove embryonic stem cells from embryo and grow in culture Induce stem cells to form specialized cells for therapeutic use Figure 11.13-5

  34. Embryonic Stem Cells • Embryonic stem cells (ES cells) • Are derived from blastocysts • Can give rise to specific types of differentiated cells

  35. Adult Stem Cells • Adult stem cells • Are cells in adult tissues • Generate replacements for nondividing differentiated cells • Unlike embryonic ES cells, adult stem cells • Are partway along the road to differentiation • Usually give rise to only a few related types of specialized cells

  36. Adult stem cells in bone marrow Blood cells Nerve cells Cultured embryonic stem cells Heart muscle cells Different culture conditions Different types of differentiated cells Figure 11.15

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer