D- Fundamentals of Nucleic Acid Biochemistry: RNA

1. D-Fundamentals of Nucleic Acid Biochemistry: RNA

2. DNA AND RNA: BASIC STRUCTURE

3. Repeating Nucleotide Subunits In DNA and RNA

4. STRUCTURE OF RNA • SUGAR • Ribose • Phosphate group • Nitrogen containing base • Adenine • Guanine • Cytosine • Uracil

5. THE NUCLEOTIDE: RNA OH O=P-O-5CH2 BASE OH O 4C 1C H H H H 3C 2C OH 0H Adenine Guanine Cytosine Uracil

6. The Forms Of RNA: Not Just Another Helix • Does not normally exist as a double helix, although it can under some conditions • Can have secondary structure: • Hairpins: pairing of bases within 5-10 nt • Stem-loops: pairing of bases separated by >50 nt • Can have tertiary structure: • Pseudoknot, cloverleaf

7. RNA Structures

8. Structure Of RNA

9. Structure of tRNA

10. Structure of rRNA

11. RNA Replication vs. DNA Replication • RNA replication: • Requires no priming • Has many more initiation sites • Is slower (50–100 b/sec vs. 1000 b/sec) • Has lower fidelity • Is more processive

12. Transcription • Transcription is the enzyme-dependent process of generating RNA from DNA. • The process is catalyzed by a DNA-dependent RNA polymerase enzyme. • Only “coding” segments of DNA (genes) are transcribed. • Types of genes include structural genes (encode protein), transfer RNA (tRNA), and ribosomal RNA (rRNA).

13. Transcription • Transition from DNA to RNA • Initiation: Gene recognition • RNA polymerase enzyme and DNA form a stable complex at the gene promoter. • Promoter: Specific DNA sequence that acts as a transcription start site. • Synthesis of RNA proceeds using DNA as a template. • Only one strand (coding strand) is transcribed, the other strand has structural function. • Transcription factors are proteins that function in combination to recognize and regulate transcription of different genes. • Termination signal

15. RNA POLYMERASES • Cellular RNA polymerase • RNA pol I transcribes rRNA genes • RNA pol II transcribes protein encoding genes • RNA pol III transcribes tRNA genes • Viral RNA polymerases • Reverse transcriptase of retroviruses • RNA dependent RNA polymerases of negative stranded viruses

16. RNA Polymerase Enzymes(DNA-dependent RNA Polymerase) • RNA Polymerase I transcribes most rRNA genes (RNA component of ribosomes). • RNA Polymerase II transcribes structural genes that encode protein. • RNA Polymerase III transcribes tRNA genes (for transfer RNAs). • RNA Polymerase IV is the mitochondrial RNA polymerase enzyme.

18. RNA TRANSCRIPTION

19. Enhancer Region Promoter Region Regulatory Proteins Regulatory Proteins RNA Polymerase II TFIID TATA 200–2000 bp 100–200 bp ~30 bp 200–10,000 bp General Organization of a Eukaryotic Gene Promoter/Enhancer

20. Upstream Downstream Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4 5´ 3´ Promoter 3´- UTR (Untranslated Region) Polyadenylation Signal 5´- UTR (Untranslated Region) Gene Structure

21. Nuclear Processing of RNA • Chemical modification reactions (addition of the 5´ CAP) • Splicing reactions (removal of intronic sequences) • Polyadenylation (addition of the 3´ polyA tail)

22. Processing of mRNA • In eukaryotes, the mRNA molecule that is released after transcription is called precursor mRNA or pre-mRNA. • It undergoes several changes before being exported out of the nucleus as mRNA.

23. Processing of mRNA • 5’ end is capped with a modified form of the G nucleotide known as the 5’ cap • At the 3’ end, an enzyme adds a long series of A nucleotides referred to as a poly-A tail • It serves to protect the mRNA from enzymes in the cytoplasm that may break it down • The greater the length of the poly-a tail, the more stable the mRNA molecule

24. RNA Transcription and Processing • The process of RNA transcription results in the generation of a primary RNA transcript (hnRNA) that contains both exons (coding segments) and introns (noncoding segments). • The noncoding sequences must be removed from the primary RNA transcript during RNA processing to generate a mature mRNA transcript that can be properly translated into a protein product.

25. RNA Processing • Capping of the 5´-end of mRNA is required for efficient translation of the transcript (special nucleotide structure). • Polyadenylation at the 3´-end of mRNA is thought to contribute to mRNA stability (PolyA tail). • Once processed, the mature mRNA exits the nucleus and enters the cytoplasm where translation takes place.

26. Genomic DNA Boundary Genomic DNA Boundary Transcriptional Promoter Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 Gene Structure in Chromosomal DNA Transcription Initiator ATG Stop Codon PolyA Signal Primary RNA Transcript Posttranscriptional Processing Initiator ATG Stop Codon PolyA Tail Mature mRNA Transcript RNA ProcessingBiogenesis of Mature mRNA

27. Primary RNA Transcript Exon 1 Intron 1 Exon 2 …NNAG GUAAGU CAG GNNN… Exon 1 Exon 2 5´ Splice Junction 3´ Splice Junction RNA Splicing Exon 1 Exon 2 Mature RNA Transcript RNA ProcessingFundamentals of RNA Splicing

28. RNA Processing: Spliceosomes • Ribonucleoproteins (snRNPs) function in RNA processing to remove intronic sequences from the primary RNA transcript (intron splicing). • Alternative splicing allows for the generation of different mRNAs from the same primary RNA transcript by cutting and joining the RNA strand at different locations. • snRNPs are composed of small RNA molecules and several protein molecules. • Five subunits form the functional spliceosome.

29. Normal Splice Site Alternative Splice Site Exon 1 Exon 2 Exon 3 RNA Splicing Normal Transcript Alternative Transcript RNA ProcessingAlternative Splicing of RNA

30. Structural Genes Encode Proteins • The majority of structural genes in the human genome are much larger than necessary to encode their protein product. • Structural genes are composed of coding and noncoding segments of DNA.

31. Structural Genes Encode Proteins • The structure of a typical human gene includes informational sequences (coding segments termed exons) interrupted by noncoding segments of DNA (termed introns). • The exon-intron–containing regions of genes are flanked by non transcribed segments of DNA that contribute to gene regulation.

32. Factors That Control Gene Expression Include: • Cis elementsare DNAsequences. • Trans elementsare proteins.

33. Control of Gene Expression • Primary level of control is regulation of gene transcription activity. • TATA box contained within the gene promoter provides binding sites for RNA polymerase. • Enhancer sequences can be sited very far away from the gene promoter and provide for tissue-specific patterns of gene expression.

34. 5´ Exon 1 Intron 1 Enhancer 5´-UTR Promoter 1. Enhancer sequences are usually sited a long distance from the transcriptional start site. 2. Enhancers maintain a tissue-specific or cell-specific level of gene expression. 3. The gene promoter contains TATA box upstream of transcription start site. Gene Enhancer Sequences

35. Protein binding sequences in the ‘Promoter’ region

36. Gene Regulation: Two types of regulation • Negative regulation • Substrate induction (lac operon): gene OFF unless substrate is present • End product repression (trp operon): gene OFF if end product is present • Common in bacteria • Positive regulation • Gene is OFF until a protein turns it ON • Regulatory proteins turn gene ON • Occurs in eukaryotes

37. Negative Regulation

38. Positive Regulation

39. Lac Operon • Operon • Gene organization in bacteria in which several proteins are coded by one mRNA • Allows all proteins to be controlled together

40. Differences Between Prokaryotes And Eukaryotes • Prokaryote gene expression typically is regulated by an operon, the collection of controlling sites adjacent to protein-coding sequence. • Eukaryotic genes also are regulated in units of protein-coding sequences and adjacent controlling sites, but operons are not known to occur. • Eukaryotic gene regulation is more complex because eukaryotes possess a nucleus (transcription and translation are not coupled).

41. Two “Categories” Of Eukaryotic Gene Regulation • Short-term - genes are quickly turned on or off in response to the environment and demands of the cell. • Long-term - genes for development and differentiation.

42. Eukaryote Gene Expression Is Regulated At Six Levels • Transcription • RNA processing • mRNA transport • mRNA translation • mRNA degradation • Protein degradation

43. Transcription Control Of Gene Regulation Controlled By Promoters • Occur upstream of the transcription start site. • Some determine where transcription begins (e.g., TATA), whereas others determine if transcription begins. • Promoters are activated by highly specialized transcription factor (TF) proteins (specific TFs bind specific promoters). • One or many promoters (each with specific TF proteins) may occur for any given gene. • Promoters may be positively or negatively regulated.

44. Transcription Control Of Gene Regulation Controlled By Enhancers • Occur upstream or downstream of the transcription start site. • Regulatory proteins bind specific enhancer sequences; binding is determined by the DNA sequence. • Loops may form in DNA bound to TFs and make contact with enhancer elements. • Interactions of regulatory proteins determine if transcription is activated or repressed (positively or negatively regulated).

45. Chromosome Structure, Eukaryote Chromosomes, And Histones • Prokaryotes lack histones and other structural proteins, so access to the DNA is straightforward. • Eukaryotes possess histones, and histones repress transcription because they interfere with proteins that bind to DNA. • Verified by DNase I sensitivity experiments: • DNase I readily degrades transcriptionally active DNA. • Histones shield non-transcribed DNA from DNase I, and DNA does not degrade as readily.

46. Chromosome Structure, Eukaryote Chromosomes, And Histones • If you experimentally add histones and promoter binding proteins; histones competitively bind to promoters and inhibit transcription. • Solution: transcriptionally active genes possess looser chromosome structures than inactive genes. • Histones are acetylated and phosphorylated, altering their ability to bind to DNA. • Enhancer binding proteins competitively block histones if they are added experimentally with histones and promoter-binding TFs. • RNA polymerase and TFs “step-around” the histones/nucloesome and transcription occurs.

47. Genomic Imprinting(Silencing) • Methylation of DNA inhibits transcription of some genes. • Methylation usually occurs on cytosines or adenines. • 5-methyl cytosine • N-6 methyl adenine • N-4 methyl cytosine • CpG islands are sites of methylation in human DNA. CpG Island …ggaggagcgcgcggcggcggccagagaaaaa gccgcagcggcgcgcgcgcacccggacagccgg cggaggcggg...

48. DNA Methylation And Transcription Control • Small percentages of newly synthesized DNAs (~3% in mammals) are chemically modified by methylation. • Methylation occurs most often in symmetrical CG sequences. • Transcriptionally active genes possess significantly lower levels of methylated DNA than inactive genes. • A gene for methylation is essential for development in mice (turning off a gene also can be important). • Methylation results in a human disease called fragile X syndrome; FMR-1 gene is silenced by methylation.

49. Hormone Regulation: Example Of Short-term Regulation Of Transcription • Cells of higher eukaryotes are specialized and generally shielded from rapid changes in the external environment. • Hormone signals are one mechanism for regulating transcription in response to demands of the environment. • Hormones act as inducers produced by one cell and cause a physiological response in another cell.

50. Hormone Regulation: Example Of Short-term Regulation Of Transcription • Hormones act only on target cells with hormone specific receptors, and levels of hormones are maintained by feedback pathways. • Hormones deliver signals in two different ways: • Steroid hormones pass through the cell membrane and bind cytoplasmic receptors, which together bind directly to DNA and regulate gene expression. • Polypeptide hormones bind at the cell surface and activate transmembrane enzymes to produce second messengers (such as cAMP) that activate gene transcription.