chmi 2227f biochimie i n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
CHMI 2227F Biochimie I PowerPoint Presentation
Download Presentation
CHMI 2227F Biochimie I

Loading in 2 Seconds...

play fullscreen
1 / 29

CHMI 2227F Biochimie I - PowerPoint PPT Presentation


  • 149 Views
  • Uploaded on

CHMI 2227F Biochimie I. Acides nucléiques: structure propriétés physico-chimiques. Acides nucléiques. Découverts en 1869 par Friedrich Meischer: Composé acide présent dans le noyau cellulaire; Donne le nom de nucléine à ce composé;

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

CHMI 2227F Biochimie I


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
    Presentation Transcript
    1. CHMI 2227FBiochimie I Acides nucléiques: structure propriétés physico-chimiques CHMI 2227 - E.R. Gauthier, Ph.D.

    2. Acides nucléiques • Découverts en 1869 par Friedrich Meischer: • Composé acide présent dans le noyau cellulaire; • Donne le nom de nucléine à ce composé; • Plus tard, d’autres scientifiques déterminent que les acides nucléiques sont composés de: • Phosphore • Azote • Carbone • Oxygène • Deux types d’acides nucléiques: • Acide déoxyribonucléique (ADN) • Acide ribonucléique (ARN) • Et pis après? Kossé ça donne tout ça???? CHMI 2227 - E.R. Gauthier, Ph.D.

    3. 35S dans les protéines seulement (Met/Cys) 32P seulement dans les acides nucléiques Hershey et ChaseL’expérience du Waring blender… CHMI 2227 - E.R. Gauthier, Ph.D.

    4. Il existe 5 bases azotées: Purines: Adénine Guanine Pyrimidines Cytosine Thymine Uracile Nature des acides nucléiques1. bases azotées CHMI 2227 - E.R. Gauthier, Ph.D.

    5. Deux types de sucres à 5 carbones sont retrouvés dans les acides nucléiques: Ribose (ARN) 2’Désoxyribose (ADN) Configuration des sucres: 2’ endo: C2’ au-dessus du cycle 3’ endo: C3’ au dessus du cycle Nature des acides nucléiques 2. sucres CHMI 2227 - E.R. Gauthier, Ph.D.

    6. La formation d’une liaison covalente (lien glycosidique) entre le sucre et la base azotée forme un nucléoside Lien glycosidique H 9 1 H 1’ 1’ Deoxyadenosine Cytidine Nature des acides nucléiques 3. nucléosides CHMI 2227 - E.R. Gauthier, Ph.D.

    7. Nature des acides nucléiques 3. nucléosides CHMI 2227 - E.R. Gauthier, Ph.D.

    8. Nature des acides nucléiques 3. nucléosides CHMI 2227 - E.R. Gauthier, Ph.D.

    9. Beta b Gamma g Alpha a Déoxythymidine 5’triphosphate Guanosine 5’monophosphate Nature des acides nucléiques 4. nucléotides • Les nucléotides sont des nucléosides portant un ou plusieurs groupesphosphates, généralement à la position 5’ du sucre; CHMI 2227 - E.R. Gauthier, Ph.D.

    10. Nature des acides nucléiques 4. nucléotides CHMI 2227 - E.R. Gauthier, Ph.D.

    11. Les nucléotides et les déoxynucléotides forment des polymères appelés polynucléotides Les nucléotides sont liés ensemble via une liaison phosphodiester; Implique le 3’OH d’un nucléotide et le phosphate a en positon 5’ d’un autre nucléotide; L’ordre des bases dans un polynucléotide est la structure primaire ou la séquence de l’acide nucléique; Les polynucléotides ont une polarité: Extrémité 5’ : le phosphate 5’ n’est pas impliqué dans une liaison phosphodiester Extrémité 3’ : le 3’OH n’est pas impliqué dans une liaison phosphodiester; Nature des acides nucléiques 5. les polynucléotides CHMI 2227 - E.R. Gauthier, Ph.D.

    12. g b a http://www.mbi.ufl.edu/facilities/msg/bch4024m/lecture45.pdf Nature des acides nucléiques 5. les polynucléotides CHMI 2227 - E.R. Gauthier, Ph.D.

    13. Nature des acides nucléiques 6. Les règles de Chargaff CHMI 2227 - E.R. Gauthier, Ph.D.

    14. L’ADN est formé de deux chaînes de polynucléotides antiparallèles (vont dans des directions opposées); Les bases sont presque perpendiculaires à l’axe (inclinaison de 6o); Les bases sont enfouies à l’intérieur de la structure, avec le squelette sucre-phosphate à l’extérieur; Les deux chaînes sont maintenues ensemble via la formation de ponts H entre bases azotées: A forme 2 ponts H avec T (paire de base AT) G forme 3 ponts H avec C (paire de base GC) Cette relation A:T et G:C dicte la complémentarité des deux chaînes: La nature de la base sur un brin donne immédiatement la nature de la base sur le brin opposé; bases Squelette sucre-phosphate Structure des acides nucléiques1. ADN CHMI 2227 - E.R. Gauthier, Ph.D.

    15. Les deux chaînes polynucléotidiques forment une hélice droite: Environ 10 paires de bases par tour d’hélice; 3.4 Å par 34 Å par tour 20 Å de diamètre Sucre: 2’ endo Lien glycosidique: anti Présence de deux crevasses à la surface de l’hélice: Petite crevasse: faible distance entre les deux chaînes; Grande crevasse: plus grand espace entre les deux chaînes; Structure des acides nucléiques1. ADN CHMI 2227 - E.R. Gauthier, Ph.D. 1 Å (Ångstrom) = 0.1 nm = 1 x 10-10 m

    16. Stabilité de l’hélice: Plusieurs ponts H entre les deux chaînes; 2 ponts H pour AT 3 ponts H pour GC Empilement des bases (p.ex. pile de pièces de monnaie): L’empilement de paires de bases GC est plus stable; Donc, une molécule d’ADN riche en GC sera plus stable qu’une molécule d’ADN contenant plus de AT; Structure des acides nucléiques1. ADN CHMI 2227 - E.R. Gauthier, Ph.D.

    17. Les molécules hybrides ADN/ARN ainsi que les duplexes d’ARN suivent les mêmes règles de base que l’ADN: Complémentarité Antiparallélisme Cependant, le 2’OH de l’ARN affecte la structure de l’hélice: Plus large: 26 Å Plus courte: 11 bp/turn Distance par paire de base: 2.6 Å Les bases sont plus inclinées (20o) Configuration des sucres: 3’endo Structure des acides nucléiques2. Duplex ARN/ARN et ADN/ARN CHMI 2227 - E.R. Gauthier, Ph.D.

    18. Structure des acides nucléiques2. Duplex ARN/ARN et ADN/ARN CHMI 2227 - E.R. Gauthier, Ph.D.

    19. Structure des acides nucléiques • Java applets: • http://www.moleculesinmotion.com/ CHMI 2227 - E.R. Gauthier, Ph.D.

    20. Les acides nucléiques absorbent à ~260 nm (à cause des bases puriques/pyrimidiques); Généralement: les préparations d’acides nucléiques pures donnent un rapport A260/A280 d’environ1.8; Des valeurs de A260/A280 inférieures à 1.8 sont généralement indicatives de la contamination des acides nucléiques par des protéines. Pourquoi??? Petit truc: une absorbance de 1 à 260 nm donne: 50 µg / ml d’ADN 40 µg / ml d’ARN ADN: Absorbance CHMI 2227 - E.R. Gauthier, Ph.D.

    21. Les acides nucléiques double brins (db) (ds) peuvent être convertis en acides nucléiques simple brins (sb) (i.e. dénaturés) de plusieurs façons: Augmentation de la température Diminution de la concentration de sel Produits chimiques: NaOH/formamide/formaldéhyde (brisent les ponts H) Inversement, l’ADN sb peut être renaturé de la façon suivante: : Diminution de la température Augmentation de la concentration en sel Ce phénomène peut être suivi par spectrophotométrie: Les acides nucléiques sb absorbent davantage à 260 nm que les acides nucléiques db: hyperchromicité; Dénaturation de l’ADN CHMI 2227 - E.R. Gauthier, Ph.D.

    22. La température à laquelle 50% de l’acide nucléique db s’est dénaturé est appelée la température de fusion (Tm); Le Tm est affecté par plusieurs facteurs: Concentration en sels: Tm augmente avec la [NaCl]; Longueur des molécules: Tm augmente avec la longueur (pour ADN < 150 pb) Contenu en G+C: Plus le contenu en GC est élevé, plus le Tm sera aussi élevé; Tm = 4 (G + C) + 2 (A+T) Quel est le Tm de la molécule d’ADN suivante: 5’GACTAGATCGATGGCTTCGATACC3’ 3’CTGATCTAGCTACCGAAGCTATGG5’ DNA#1 Hyperchromicité DNA#2 Dénaturation de l’ADN CHMI 2227 - E.R. Gauthier, Ph.D.

    23. G+C-rich A+T-rich Dénaturation de l’ADN CHMI 2227 - E.R. Gauthier, Ph.D.

    24. Les acides nucléiques sb ayant des séquences complémentaires vont se renaturer lorsqu’elles seront mélangées ensemble (hybridation); ADN-ADN ADN-ARN ARN-ARN La renaturation se produira même si les deux brins ne sont pas parfaitement complémentaires; Cependant, le Tm diminuera avec le nombre de différences dans la complémentarité; Ce phénomène est très utilisé lors de l’étude des acides nucléiques: Séquençage PCR Analyse Southern Analyse Northern Analyse FISH Puces à ADN Hybridation CHMI 2227 - E.R. Gauthier, Ph.D.

    25. - + Power • L’agarose est un polymère poreux qui permet le mouvement des molécules d’ADN Microscopie électronique à balayage d’un gel d’agarose (1×1 µm)  Électrophorèse en gel d’agarose ADN CHMI 2227 - E.R. Gauthier, Ph.D.

    26. Molécules d’ADN De longueur connue Staining with ethidium bromide Courbe standard: Log longueur vs distance migrée Le bromure d’éthidium fluoresce rouge seulement lorsqu’il s’intercale entre les paires de bases. Électrophorèse en gel d’agarose CHMI 2227 - E.R. Gauthier, Ph.D.

    27. Hybridation Une sonde d’acide nucléique marquée au 32P n’est complé-mentaire qu’à une seule des molécules d’ADN présentes sur le gel Analyse Southern et Northern • Analyse Southern: des molécules d’ADN sont séparées sur le gel et hybridées; • Utilisé fréquemment pour étudier la structure des gènes; • Analyse Northern: des molécules d’ARN sont séparées sur le gel et hybridées: • Très utilisé pour déterminer le lieu et l’intensité de l’expression d’un gène d’intérêt. CHMI 2227 - E.R. Gauthier, Ph.D.

    28. ADN génomique coupé avec une enzyme de restriction Allèle différente des autres? Analyse Southern CHMI 2227 - E.R. Gauthier, Ph.D.

    29. Le FISH est utilisé pour déterminer la position d’un gène sur un chromosome; Une sonde d’acide nucléique fluorescente et complémentaire au gène d’intérêt est hybridée à des chromosomes; FISHFluorescent in-situ hybridization CHMI 2227 - E.R. Gauthier, Ph.D.