Chmi 2227f biochimie i
Download
1 / 33

CHMI 2227F Biochimie I - PowerPoint PPT Presentation


  • 93 Views
  • Uploaded on

CHMI 2227F Biochimie I. Acides nucléiques: réplication. DNA. Nucleus. Réplication de l’ADN. 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’. 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’. 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’. Réplication de l’ADN.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' CHMI 2227F Biochimie I' - jean


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Chmi 2227f biochimie i

CHMI 2227FBiochimie I

Acides nucléiques:

réplication

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn

DNA

Nucleus

Réplication de l’ADN

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn1

5’AGCTAGCTGATATCGCGATCG3’

3’TGCATCGACTATAGCGCTAGC5’

5’AGCTAGCTGATATCGCGATCG3’

3’TGCATCGACTATAGCGCTAGC5’

5’AGCTAGCTGATATCGCGATCG3’

3’TGCATCGACTATAGCGCTAGC5’

Réplication de l’ADN

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn2
Réplication de l’ADN

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 1 conservation des brins parentaux

Non-conservatif

Conservatif

Dispersif

Semi-conservatif

Réplication de l’ADN 1) Conservation des brins parentaux

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 1 l exp rience de meselson et stahl

PNAS 1958;44;671-682

Réplication de l’ADN 1) L’expérience de Meselson et Stahl

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 2 directionalit de la r plication

Fourches de

réplication

Réplication de l’ADN 2) Directionalité de la réplication

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn la fourche de r plication

5’

5’

Fourche de

réplication

3’

5’

3’

Direction de la

fourche de réplication

3’

5’

Réplication de l’ADN La fourche de réplication

3’

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn les mol cules d adn peuvent poss der plusieurs fourches de r plication
Réplication de l’ADNLes molécules d’ADN peuvent posséder plusieurs fourches de réplication

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 2 directionalit de la r plication1
Réplication de l’ADN 2) Directionalité de la réplication

3’

5’

5’

3’

3’

5’

5’

3’

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 2 directionalit de la r plication2
Réplication de l’ADN 2) Directionalité de la réplication

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 2 directionalit fragments d okazaki
Réplication de l’ADN 2) Directionalité : Fragments d’Okazaki

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn la fourche de r plication1
Réplication de l’ADN La fourche de réplication

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 nature de la machinerie de r plication
Réplication de l’ADN 3) Nature de la machinerie de réplication

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 adn polym rase
Réplication de l’ADN 3) ADN polymérase

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 adn polym rase1
Réplication de l’ADN 3) ADN polymérase

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 adn polym rase2
Réplication de l’ADN 3) ADN polymérase

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 adn polym rase iii de e coli
Réplication de l’ADN 3) ADN polymérase III de E. coli

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 adn polym rase iii de e coli1

(Clamp loader)

(ADN polymérase)

Réplication de l’ADN 3) ADN polymérase III de E. coli

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 adn polym rase iii de e coli2
Réplication de l’ADN 3) ADN polymérase III de E. coli

http://oregonstate.edu/instruction/bb492/figletters/FigG1.html

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 adn polym rase iii de e coli3

Place

ADN

Ici!!

Direction de la réplication

Sliding clamp

Réplication de l’ADN 3) ADN polymérase III de E. coli

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 3 primase
Réplication de l’ADN 3) Primase

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn initiation de la synth se de l adn
Réplication de l’ADN Initiation de la synthèse de l’ADN

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn synth se du brin meneur

Déroule l’ADN

http://oregonstate.edu/instruction/bb492/figletters/FigH4.html

Réplication de l’ADN Synthèse du brin meneur

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn synth se du brin retardataire
Réplication de l’ADN Synthèse du brin retardataire

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn brin retardataire
Réplication de l’ADN Brin retardataire

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn adn ligase

Lien

phosphodiester

manquant

Réplication de l’ADN - ADN ligase

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 4 dition
Réplication de l’ADN4) Édition

CHMI 2227 - E.R. Gauthier, Ph.D.


R plication de l adn 4 dition1
Réplication de l’ADN4) Édition

CHMI 2227 - E.R. Gauthier, Ph.D.


S quen age de l adn
Séquençage de l’ADN

CHMI 2227 - E.R. Gauthier, Ph.D.


PCR

CHMI 2227 - E.R. Gauthier, Ph.D.


PCR

CHMI 2227 - E.R. Gauthier, Ph.D.



ad