1 / 26

Synthetic Biology at the Joint BioEnergy Institute (JBEI)

Synthetic Biology at the Joint BioEnergy Institute (JBEI). CO 2. Biomass. Sugars. Fuels. Plants. Microbes. Josh Gilmore ERDC 2011-6-13. The Rumpelstiltskin Model. Sequence wrangling. Cell Wrangling. Sequence Wrangling. Device Editor J5 Clotho.

alicia
Download Presentation

Synthetic Biology at the Joint BioEnergy Institute (JBEI)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Synthetic Biology at the Joint BioEnergy Institute (JBEI) CO2 Biomass Sugars Fuels Plants Microbes Josh Gilmore ERDC 2011-6-13

  2. The Rumpelstiltskin Model Sequence wrangling Cell Wrangling

  3. Sequence Wrangling Device Editor J5 Clotho High-throughput cloning software and hardware Nathan Hillson and Doug Densmore

  4. Cell Wrangling Biofuel Resistance Pumps Mary Dunlop

  5. Cell Wrangling Dynamic Pathway Control Traditional Pathway Control placUV5 native ptet constitutive pBAD Externally regulated Native or no regulation Many expression control tools are now available 5’ upstream promoter 5’ UTR RBS Codon Usage Tags 3’ UTR Target Gene 3’ downstream

  6. Cell Wrangling SynBerc BioFab Expression Operating Unit (EOU) Nucleus Synthetic light collecting structure • Standardize context (EOU) • Generate/characterize parts and insulated junctions • Elucidate contextual dependencies • Build predictive models Vivek Mutalik

  7. Biocomputing Natural systems can solve interesting problems Adaptive Network Design in Physarum polycephalum Hot Ice Pathfinding Hot Ice Computer, Andrew Adamatzky arXiv:0908.4426v1 August 2009 Rules for Biologically Inspired Adaptive Network Design Atsushi Tero, et al. Science 327, 439 (2010)

  8. Making circuits more like cells Solving mazes with memristors: a massively-parallel approach Yuriy V. Pershin & Massimiliano Di Ventra arxiv.org

  9. Making cells more like circuits Synthetic systems rebuild simple circuits Oscillator Counter Synthetic Gene Networks That Count Ari E. Friedland, et al. Science 324, 1199 (2009) A synthetic oscillatory network of transcriptional regulators Michael B. Elowitz & Stanislas Leibler NATURE |VOL 403 | 20 JANUARY 2000

  10. Biocomputing at JBEI Microbes Plants

  11. Zinc finger logic for signal processing Signal Processing Will Holtz

  12. NOR gates can build all logic functions NOR NOT OR AND a large number of orthogonal NOR gates are needed Will Holtz

  13. Constructing an orthogonal ZFP Library mCherry Will Holtz

  14. Orthogonal ZFPs with cognate promoters 1 = no interaction 0 = fully attenuated Will Holtz

  15. Recombinases as a candidate for robust processing att att Flp Flp complex: Nigel D.F. Grindley, Katrine L. Whiteson, and Phoebe A. Rice Annu. Rev. Biochem.2006. 75:567–605

  16. Recombinase Function att att rec att att

  17. ATAACTTCGTATAGCATACATTATACGAAGTTAT TATTGAAGCATATCGTATGTAATATGCTTCAATA Recombinase Function Grindley et al. Annu. Rev. Biochem., 2006, 75, 567-605 loxP recognition site

  18. Recombinases are (almost) Turing complete Read, Write, and Erase att att att att Except for Scars att

  19. A B A B A B Two Limiting Factors 50% 100% 25% Reversibility 50% 25% 25% Tim Ham Fully Scrambled 25% Cross Reactivity

  20. cre flp cre flp cre flp cre cre cre ? Does equal dre dre dre dre dre dre Searching for Orthogonality cre flp dre

  21. dre dre Results cre-cre cre-dre cre-flp dre-dre controls cre Unexcisable RFP Pseudoscar cre with Andrew Lee

  22. Seven Enzymes and Cognate Sites with Raymond Lam and Betty Wong

  23. Seven Enzymes and Cognate Sites with Raymond Lam and Betty Wong

  24. What can recombination do for you? Robust cloning toolkits with recombinase systems 1 inducer no side rxns A. B. C. A. Genome-wide modifications can be carried out simultaneously in-vivo with a single induction event using orthogonal recombinases. B. Excision activated cassettes can be used to generate divergent populations or cause a short spike in the production of a gene. C. A similar concept can be used to cure plasmids by separating the origin from the antibiotic resistance cassette. Demonstration of excision controlled logic devices and memory Logic gates and temporal memory elements can be constructed from orthogonal recombinase cassettes. By interweaving att sites, a dependency is created where expression of the first recombinase induces expression of a fluorescent protein while also disabling another recombinase cassette. This can be dramatically demonstrated by watching an induction front form in a plate gradient experiment. More sophisticated logic elements can also be constructed. We are currently collaborating to use these devices to track cancer metastasis.

  25. Acknowledgements Jay Keasling SynBerc Will Holtz Nathan Hillson (Director of Synthetic Biology for Fuels Synthesis) Vivek Mutalik (on behalf of the SynBerc BioFab) Mary Dunlop Doug Densmore Andrew Lee, Raymond Lam, Betty Wong

More Related