1 / 36

Chapter 13 RFLPs, VNTRs, STRs and PCR

Chapter 13 RFLPs, VNTRs, STRs and PCR. RFLP restriction fragment length polymorphism has been the workhorse of forensic DNA for many years.

porter-rhodes
Download Presentation

Chapter 13 RFLPs, VNTRs, STRs and PCR

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Chapter 13 RFLPs, VNTRs, STRs and PCR

  2. RFLP restriction fragment length polymorphismhas been the workhorse of forensic DNA for many years • Alec Jeffries an English geneticist first described RFLP in 1985. RFLP makes use of the fact that certain regions in our genomes have DNA sequences that are repeated over and over again. These regions are known as • VNTR (Variable Number Tandem Repeats). Jeffries found that the number of repeats at any particular location differs from person to person. Using restriction enzymes Jeffries was able to cut out the VNTRs and compare their sizes directly. (See Human Heredity text page 291- A Boy of Ghanaian descent)

  3. Minisatellitesare sequences of DNA base pairs, ranging from 14 to 100 nucleotides long that are organized into clusters of tandem repeats, for example the sequence: CCTTCCCTTCCCTTCCCTTC Is made up of four tandemly repeated copies of the 5 nucleotide sequence CCTTC. Such clusters are found on all chromosomes. There are many different minisatellite sequences, and the number of repeats at each site is variable ranging from 2 to more than 100. Each variant is an allele, and they are inherited codominantly. These minisatellites are called variable number tandem repeats (VNTRs)

  4. VNTR’s can be cut with restriction enzymes and visualized with Gel Electro-phoresis http://ihome.cuhk.edu.hk/~z045513/virtuallab/animation/vntr.html

  5. VNTR vsSTRShortTandemRepeats STRs are similar to VNTRs, since they both describe regions of DNA where one finds DNA sequences repeated over and over again. STRs are shorter versions of VNTRs. Sometimes only 2 nucleotides repeat in STRs. Both types of repeats are inherited from ones parents. For each locus one comes from the mom and one comes from the dad.

  6. VNTR vsSTRShortTandemRepeats STRs (are much easier to analyze than VNTRs because they are small and easy to amplify with PCR (Polymerase Chain Reaction).

  7. What is DNA profiling? DNA profiling or fingerprinting is the use of molecular genetic methods to determine the exact genotype of a DNA sample in a way that can basically distinguish one human being from another The unique genotype of each sample is called a DNA profile.

  8. How do crime scene investigators create a DNA profile? 1. Evidence is collected at the crime scene: Blood Tissue Semen Urine Hair Teeth Saliva Bone

  9. How do crime scene investigators create a DNA profile? • 2. DNA is extracted from sources at the crime scene and from victim and suspects

  10. DNA Quantitation PCR Amplification of multiple (STR) markers Sample Genotype Determination Generation of Case Report with Probability of Random Match If match occurs, comparison of DNA profile to population databases How do crime scene investigators create a DNA profile? • 3. DNA samples are processed Sample Obtained from Crime Scene or Paternity Investigation Biology DNA Extraction Technology Separation and Detection of PCR Products (STR Alleles) Genetics Comparison of Sample Genotype to Other Sample Results

  11. 4. Crime Scene Investigators search in areas of the genome that are unique from individual to individual and are “anonymous”(control no known trait or function) The areas examined are Short Tandem Repeats or STR’s • STR region Since humans are 99.5% identical where do crime scene investigators look for differences in DNA profiles? The remaining 15 million nucleotides determines the difference between people

  12. Example of an STR: TH01 • The TH01 locus, found on chromosome #11, contains repeats of TCAT. • CCC TCAT TCATTCATTCATTCATTCATAAA • 1 2 3 4 5 6 • This example has 6 TCAT repeats. • There are more than 20 known TH01 alleles. • Each individual inherits 1 allele from each parent.

  13. Determining genotypes for individuals using STRs • Mr. Zynda’sTH01 locus for his two chromosomes is given below. • CHROMOSOME from MOM • CCC TCAT TCATTCATTCATTCATTCAT AAA • CHROMOSOME from DAD • CCC TCAT TCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATAAA • His genotype would be 6*14* What is his TH01 genotype? Instead of “A a” we could express it as: 6* 14* Where *= the number of TCAT repeats

  14. 5’ 3’ Starting DNA Template 3’ 5’ Target DNA To determine the genotype (DNA profile) Crime Scene Investigators make billions of copies of the target sequence using PCR (Polymerase Chain Reaction).This done instead of cutting the tandem repeat out with restriction enzymes. PCR

  15. What’s the point of PCR? • PCR, or the polymerase chain reaction, makes copies of a specific piece of DNA • PCR allows you to look at one specific piece of DNA by making copies of *only* that piece of DNA Literary Analogy: • PCR is like photocopying just one page rather then checking out all the books in a library

  16. What is needed for PCR? Reverse primer 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ Forward primer Target sequence The PCR ReactionWhat do you need? • Template (containing the STR you want to amplify for the study) • Sequence-specific primers flanking the target sequence • Nucleotides (dATP, dCTP, dGTP, dTTP) • Magnesium chloride (enzyme cofactor) • Buffer, containing salt • Taq polymerase

  17. Heat (94oC) to denature DNA strands Cool (52oC) to anneal primers to template Warm (72oC) to activate Taq polymerase, which extends primers and replicates DNA Repeat 35 cycles The PCR ReactionHow does it work?

  18. Denaturing Template DNA 3’ 5’ Heat causes DNA strands to separate 3’ 5’ 3’ 5’ Denaturation of DNA at 94oC 5’ 3’

  19. Annealing Primers Primers anneal at 52oC • Primers bind to the template sequence • Taq polymerase recognizes 3’ end of primer + template strand 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ Taq extendsat 72oC 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’

  20. Cycle 1 STR DNA is replicated Cycle 2 Repeat denaturing, annealing, and extending 35 cycles Cycle 3 The exact-length target product is made in the third cycle

  21. http://highered.mcgraw-hill.com/olc/dl/120078/micro15.swf PCR Animation

  22. Allele ladder Mother Father Child C Child D Child E TH01 alleles • 2 points to this slide: • A graphic visualization of what the PCR products can look like. • In addition to crime scene investigations, STR DNA profiling can also be used to determine familial relationships. The children of any two parents will have a combination of alleles provided by the parents. (14) (13) (12) (11) (10) (9) (8) (7) (6) (5) (4) (3)

  23. 1985 Alec Jeffries develops RFLP • 1990 PCR analysis using single locus STR begins • 1992 FBI initiates STR work • 1994 DNA Identification Act: provides funding for national DNA database • 1995 OJ Simpson trial focuses public attention on DNA evidence • 1998 FBI starts CODIS database; Swissair disaster – all remains identified using STR DNA profiling • 2001 World Trade Center disaster in NYC – many remains identified using a combination of DNA profiling approaches • 2004 Indian Ocean tsunami; Interpol and other world agencies use DNA profiling to identify victims • Today Trace your Genetic Genealogy; commercially • available packages can trace paternal/maternal • ancestry Milestones in Forensic DNA analysis

  24. DNA Testing TodayGeneTree.com & Ancestry.com provide DNA tests from $99-$200 to trace genealogy

  25. high RFLP analysis STR analysis mtDNA Blood group typing low slow fast Crime scene investigators use techniques that are fast, cost effective, and have a high Power of DiscriminationThe Power of Discrimination is the ability of a test to distinguish between different samples (genotypes) Power of Discrimination Speed of Analysis

  26. Statistics of Chance: M&M Locus • 6 Possible Alleles: • Green • Red • Yellow • Blue • Brown • Orange

  27. Probabilities • One allele from each parent means 2 copies of gene/locus 1 36 1 6 1 6 X = Frequency of any M&M genotype

  28. Locus 1 6 1 6 1 36 x = M&M 6 alleles 1 25 1 5 1 5 Jolly Rancher 5 alleles x = 1 25 1 5 1 5 Mike & Ikes 5 alleles x = 1 22,500 Chance an individual has a given genotype = 1 506,250,000 Chance 2 people have the same genotype = Probabilities Jolly Rancher: 5 alleles Mike & Ikes: 5 alleles

  29. Who can’t we exclude from the pool of suspects?

  30. TPOX genotype 8-12 D3S1358 genotype 16-17 FGA genotype 21-23 The Power of Discrimination increases with the number of loci profiled 0.099 0.044 0.050 0.044 x 0.099 x 0.050 = 2.18 x 10-4 1 / 2.18 x 10-4 or 1 in 4591

  31. The Power of Discrimination increases with the number of loci profiled TPOX 8-12 0.044 D3S1358 16-17 0.099 FGA 21-23 0.050 VWA 14-14 0.0088 Random Match Probability = 1 in 5.3 x 105

  32. Real-WorldProbabilities • Forensics labs use 13 different loci with multiple alleles • Allele frequencies DO NOT follow mathematical principles - allele frequencies vary by population. • These 13 loci allow for discrimination of any two people in the world (with the exception of identical twins), living or dead. • Probability of a random match when all 13 loci typed: ~1 in 3 trillion.

  33. TH01 Published Allele Frequencies by Population www.cstl.nist.gov/biotech/strbase/pub_pres/Butler2003a.pdf Butler et al 2003 J Forensic Sci.

  34. CODISCOmbined DNA Index SystemA federally maintained database used by law enforcement officials 13 loci guarantees high power of discrimination

More Related