PCR

1. PCR M.Prasad Naidu MSc Medical Biochemistry, Ph.D,.

2. PCR methods • PCR amplifies a given sequence in an exponential fashion • In a perfect world, after 35 cycles, one starting copy of a gene would yield 236 copies of that DNA fragment—68 billion copies • Starting with 100 copies would yield 3.73 ug of DNA, plenty to be able to sequence, clone and visualize on an agarose gel • difficult to sequence one copy of a gene and detect • very easy to sequence some of the 68 billion copies and detect

3. PCR • Steps in PCR reaction • denaturation • separate parent strands in preparation new strand synthesis

4. PCR • annealing • “stick” primers to the parent strands to prime DNA synthesis • DNA synthesis requires a primer to start DNA synthesis

5. PCR • extension • addition of nucleotides, one at a time, to the growing end of the DNA strand (3’ end) using the parent strand as the template • cycle through 25-35 times

6. PCR animation

7. PCR • Considerations • incorrect PCR product size (primer design) • mis-priming • too low annealing temperature • redundant sequences • no PCR product • no priming • too high annealing temperature • primer dimers • complementary sequence in primers and they’ll anneal • too much template • forgot enzyme • forgot dNTPs • too much/too little MgCl2 • PCR product with errors • wrong temperature • annealing • extension • too much/too little MgCl2 • affects polymerase proof reading • complex sequence • GGG repeats • low fidelity enzyme • Taq polymerase vs Pfu

8. RNA RT-PCR reverse transcriptase-pcr • RNA containing virus • PCR doesn’t work on RNA templates • RT PCR • make cDNA copy of RNA sequence first • PCR the cDNA copy of RNA Extract RNA from virus/cells

9. RT-PCR • Comparison of Real Time vs traditional PCR • http://www.appliedbiosystems.com/support/tutorials/pdf/rtpcr_vs_tradpcr.pdf

10. RT detection methods • Fluorescence quenching • the fluorescence of a fluorescent molecule can be quenched by close proximity to a quenching agent • upon removal of the quencher, the fluorescence siganl returns • Exonuclease activity • DNA polymerase • ability to synthesize new DNA strand • ability to remove nucleotides from a second strand of DNA as it's moving on the template

11. Fluorescence low Fluorescence high Fluorescence high Fluorescence low RT detection methods • Second method of detection of PCR product • Detecting an increase in fluorescence intensity • Utilize a fluorophore that emits light only when complexed with dsDNA • Increasing amount of dsDNA product with each round of amplification gives a corresponding increase in fluorescence

12. PCR Primers • Go to Genbank, look up sequence of virus or organism of interest

13. PCR Primers • Info about publishers of sequence-when and who • Info about organism • Info about source of material

14. PCR Primers • Info about translation, capping, DNA sequence

15. PCR Primers 1 gtattaataa tgtcgacttc aggaactggt aagatgactc gcgcgcagcg tcgagctgcc 61 gctcgtagaa atcgtcggac cgctggggtc caaccagtaa ttgtcgaacc aatcgctgct 121 ggccaaggca aggccattaa agcgattgca ggatacagca tatcaaagtg ggaggcgtct 181 tcggacgcga ttacagcgaa agccaccaat gccatgagta tcactctgcc ccatgagctc 241 tcttctgaaa agaataagga gcttaaggtc ggcagagtgc tgctttggtt gggacttctt 301 cctagcgttg ctgggaggat taaggcttgt gttgctgaga aacaggcaca ggccgaggcc 361 gcttttcaag tagccttggc ggttgctgac tcctcgaaag aggtggtcgc ggccatgtat 421 acggacgcct ttcgaggggc gactctgggg gatttgctta atctccagat ttatctgtat 481 gcatctgaag cagtgcctgc taaggcggtc gttgtacatc tagaagttga gcacgtaagg 541 cctacgttcg atgacttctt caccccggtttataggtagt gcccctgctc ggagagcccc 601 tgactgggtt aaagtcacag gccccttgtc tcaggtagag accctgtcca ggtaggacac 661 tttggctaag gttaaaagct tgttgaatca gtacaataac tgatagtcgt ggtttacacg 721 cagacctctt acaagagtgt ctaggtgcct ttgagagtta ctctttgctc tcttcggaag 781 aacccttagg ggttcgtgca tgggcttgca tagcaagtct tagaatgcgg gtaccgtaca 841 gtgttgaaaa acactgtaaa tctctaaaag agacca • Identify gene sequence in mRNA sequence • select primers to use for RT and PCR 1 gtattaataa tgtcgacttc aggaactggt aagatgactc gcgcgcagcg tcgagctgcc 61 gctcgtagaa atcgtcggac cgctggggtc caaccagtaa ttgtcgaacc aatcgctgct 121 ggccaaggca aggccattaa agcgattgca ggatacagca tatcaaagtg ggaggcgtct 181 tcggacgcga ttacagcgaa agccaccaat gccatgagta tcactctgcc ccatgagctc 241 tcttctgaaa agaataagga gcttaaggtc ggcagagtgc tgctttggtt gggacttctt 301 cctagcgttg ctgggaggat taaggcttgt gttgctgaga aacaggcaca ggccgaggcc 361 gcttttcaag tagccttggc ggttgctgac tcctcgaaag aggtggtcgc ggccatgtat 421 acggacgcct ttcgaggggc gactctgggg gatttgctta atctccagat ttatctgtat 481 gcatctgaag cagtgcctgc taaggcggtc gttgtacatc tagaagttga gcacgtaagg 541 cctacgttcg atgacttctt caccccggtttataggtagtgcccctgctc ggagagcccc 601 tgactgggtt aaagtcacag gccccttgtc tcaggtagag accctgtcca ggtaggacac 661 tttggctaag gttaaaagct tgttgaatca gtacaataac tgatagtcgt ggtttacacg 721 cagacctctt acaagagtgt ctaggtgcct ttgagagtta ctctttgctc tcttcggaag 781 aacccttagg ggttcgtgca tgggcttgca tagcaagtct tagaatgcgg gtaccgtaca 841 gtgttgaaaa acactgtaaa tctctaaaag agacca

17. Primers • www.fisheroligo.com  (operon) • scale price/base     • 50 nmole   $0.50 • 200 nmole   $1.00 • 25 base oligo =$12.50 • www.idtdna.com • scale price/base   • 100 nmole   $0.55 • 250 nmole   $0.95 • 25 base oligo =$13.75 • www.fisheroligos.com  (sigma genosys) • scale price/base     • 50 nmole   $0.75 • 200 nmole   $1.30 • 25 base oligo =$18.75

18. Primers • Real-Time PCR Probes • Dual-labeled fluorogenic probes forTaqMan® real time quantitative PCR.www.synthegen.com • 60 nmol $500.00 • Taqman probe: • High-quality primer of minimum costEconomic PAGE/HPLC purificationwww.genscript.com • 50 nmol $120.00

19. Unknown ID • Barley came in with signs of viral infection • TEM analysis indicated a ~30 nm icosahedral particle in infected plant sap • Extracted virus from infected material • biochemical characterization • Extracted nucleic acid from virus preparation • reverse transcriptase to generate DNA copy of RNA • PCR sequence • Could have done RT PCR from nucleic acid extracted from plant via a RNA extraction kit • Passage onto uninfected host

20. genomic RNA extracted from pur. virus SDS page of viral protein unknown (BMV) CCMV unknown (BMV) CCMV Unknown ID

21. RT-PCR with BMV coat protein specific primers Dot blot of purified virus size marker CCMV BMV CCMV BMV BMV BMV a-BMV antibody a-CCMV antibody CCMV CCMV extracted RNA virus Unknown ID

22. THANK YOU