340 likes | 410 Views
Protein synthesis. http://cellbio.utmb.edu/cellbio/ribosome.htm. http://faculty.uca.edu/~johnc/mbi1440.htm. DNA vs RNA. http://www.algosobre.com.br/biologia/dna-e-rna.html. Types of RNA. Messenger RNA (mRNA): copy of DNA.
E N D
Protein synthesis http://cellbio.utmb.edu/cellbio/ribosome.htm
http://faculty.uca.edu/~johnc/mbi1440.htm DNA vs RNA
Types of RNA Messenger RNA (mRNA): copy of DNA http://www.ncbi.nlm.nih.gov/Class/MLACourse/Modules/MolBioReview/transcription.html
Types of RNA • Transfer RNA (tRNA):
Types of RNA http://www.chm.bris.ac.uk/motm/linezolid/linezolid.htm http://www.molecularassembler.com/KSRM/ListFigures.htm
http://www.langara.bc.ca/biology/mario/Biol2315notes/biol2315chap11.htmlhttp://www.langara.bc.ca/biology/mario/Biol2315notes/biol2315chap11.html
Genetic code • 20 a.a. • But only 4 RNA bases… • If 2 nucleotides, only 16 a.a. (42 = 16) • 3 nucleotides is great 43 = 64
http://www.cbs.dtu.dk/staff/dave/roanoke/genetics980320f.htm
Exercices together • Transcribe this DNA into mRNA: • ACGGTATTACCGCTA • UGCCAUAAUGGCGAU (Answer) • Now translate this mRNA into a protein: • AUGCAUUGUAUGGGUUAAGCG • Met, His, Cys, Met, Gly (stop)
Transcription • Initiation: • 1) RNA polymerase binds to DNA at a promoter region • 2) DNA unwounded and template strand exposed
Transcription • Elongation: • 1) mRNA synthesized in 5’ to 3’ using template strand • 2) elongation continues and DNA already transcribed rewinds into double-helix
Transcription • Termination: • RNA synthesis stops; mRNA and RNA polymerase are released
http://www.dadamo.com/wiki/wiki.pl/Transcription_(DNA_transcription)
Check your understanding • Biology12 Textbook • P. 241 # 1, 3-6, 8-11, 13 and 14
Posttranscriptional modifications • In eucaryotic cells • 5’ cap is added to the start. It’s a 7-methyl guanosine which protects the mRNA from digestion by nucleases and phospohotases. See p. 244 fig. 3 • Poly-A tail is added by poly-A polymerase to the 3’end. It’s to protect and helps initiate translation.
Posttranscriptional modifications • Introns are removed by spliceosomes. http://faculty.uca.edu/~johnc/rnaprot1440.htm
Check your understanding • Biology12 Textbook • P.249 # 1-5, 7-12
Translation: Elongation About 60 ms/peptide bond!
Animation of the whole protein synthesis: http://207.207.4.198/pub/flash/26/transmenu_s.swf
Check your understanding • Bio 12 p.254 # 1-4, 6, 7 and 9 • Do Activity 5.4.1 p.269-270
Point Mutation : missense and nonsense Silent mutation:
Check your understanding • Bio 12 p. 263 # 1, 6-8
Control Mechanisms • 42 000 genes in humans! • Housekeeping genes : always needed in a cell • Transcription factors turn genes on when required
4 levels of control of gene expression • Transcriptional: controls which genes are transcribed or rate of transcription • Posttranscriptional: controls posttranscription • Translational: controls how often and how fast translation happens • Posttranslational: Controls passage through membrane and rate of activation of proteins and time its remains functional.
Operon control • Operon: cluster of genes under the control of one promoter and one operator in prokaryotic cells • Operator: regulatory sequences of DNA to which a repressor protein binds
The lac operon http://fig.cox.miami.edu/~cmallery/150/gene/operon.htm
The trp operon http://fig.cox.miami.edu/~cmallery/150/gene/feedback.htm
Check your understanding • Bio12 p. 258 # 1 – 6.