chromosome 10 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Chromosome 10 PowerPoint Presentation
Download Presentation
Chromosome 10

Loading in 2 Seconds...

play fullscreen
1 / 9

Chromosome 10 - PowerPoint PPT Presentation


  • 148 Views
  • Uploaded on

Chromosome 10. Kristen Dengler. Chromosome 10!!!. 135 million base pairs long Model is 13.5 inches long About 800-1200 genes found on it Average size: (10 largest) Represents 4-4.5% of total DNA in cell. All has been sequenced . GENES OF INTEREST. CXCL12 Located at 10q11.1

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Chromosome 10' - zorana


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
chromosome 10

Chromosome 10

Kristen Dengler

chromosome 101
Chromosome 10!!!
  • 135 million base pairs long
    • Model is 13.5 inches long
  • About 800-1200 genes found on it
  • Average size: (10 largest)
  • Represents 4-4.5% of total DNA in cell.
  • All has been sequenced
genes of interest
GENES OF INTEREST
  • CXCL12
  • Located at 10q11.1
  • Resistance to AIDS
  • It directs movement of lymphocytes (white blood cells)
  • During embryogenesis it directs hematopoietic cells

q11.1

genes of interest1
GENES OF INTEREST
  • CYP17
  • Located 10q24.3
  • Makes an enzyme that enables the body to convert cholesterol into cortisol.
  • Also enables body to create hormones like testosterone. Without it puberty will not occur.
  • Mutations may be associated with prostate cancer or breast cancer.
genes of interest2
GENES OF INTEREST
  • DLG5 (Disks Large Homolog 5)
  • Located 10q23
  • Susceptibility to Crohn’s Disease
  • Works on the membrane of the cell or the cytoskeleton

q23

genes of interest3
GENES OF INTEREST
  • MAP3K8
  • Located at 10p11.2
  • Somatic Lung Cancer
  • Plays roll in cell cycle.

p11.2

linked genes
Linked Genes
  • Partial Epilepsy has been found to be linked to chromosome 10
  • Partial Epilepsy is when seizures occur in a specific area of the brain
    • Common neurological disorder
  • Linked to q arm. (Longer arm)
mutations
Mutations!!!
  • Tremor and Reduced Life Span (trls)
  • Found mutation in chromosome 10
  • Spontaneous recessive neurological mutation
  • Causes tremors, reduced body size, and a shortened life span
  • Other mutations in genes on chromosome 10 have lead to cancer and Crohns Disease
sample base sequence
Sample base sequence
  • GDF2 Gene
  • 1 cggtccagcccggcagcgggtgagagtgggtgctggccaggacggttccttcagagcaaa 61 cagcagggagatgccggcccgctccttcccagctcctccccgtgcccgct

aacacagcac 121 ggccgcctgcagtctcctctctgggtgattgcgcgggcctaagatgtgtcctggggcact 181 gtgggtggccctgcccctgctgtccctgctggctggctccctacaggggaagccactgca 241 gagctggggacgagggtctgctgggggaaacgcccacagcccactgggggtgcctggagg 301 tgggctgcctgagcacaccttcaacctgaagatgtttctggagaacgtgaaggtggattt 361 cctgcgcagccttaacctgagtggggtcccttcgcaggacaaaaccagggtggagccgcc 421 gcagtacatgattgacctgtacaacaggtacacgtccgataagtcgactacgccagcgtc 481 caacattgtgcggagcttcagcatggaagatgccatctccataactgccacagaggactt 541 ccccttccagaagcacatcttgctcttcaacatctccattcctaggcatgagcagatcac 601 cagagctgagctccgactctatgtctcctgtcaaaatcacgtggacccctctcatgacct 661 gaaaggaagcgtggtcatttatgatgttctggatggaacagatgcctgggatagtgctac 721 agagaccaagaccttcctggtgtcccaggacattcaggatgagggctgggagaccttgga 781 agtgtccagcgccgtgaagcgctgggtccggtccgactccaccaagagcaaaaataagct 841 ggaagtgactgtggagagccacaggaagggctgcgacacgctggacatcagtgtcccccc 901 aggttccagaaacctgcccttctttgttgtcttctccaatgaccacagcagtgggaccaa 961 ggagaccaggctggagctgagggagatgatcagccatgaacaagagagcgtgctcaagaa 1021 gctgtccaaggacggctccacagaggcaggtgagagcagtcacgaggaggacacggatgg 1081 ccacgtggctgcggggtcgactttagccaggcggaaaaggagcgccggggctggcagcca 1141 ctgtcaaaagacctccctgcgggtaaacttcgaggacatcggctgggacagctggatcat 1201 tgcacccaaggagtatgaagcctacgagtgtaagggcggctgcttcttccccttggctga 1261 cgatgtgacgccgacgaaacacgctatcgtgcagaccctggtgcatctcaagttccccac 1321 aaaggtgggcaaggcctgctgtgtgcccaccaaactgagccccatctccgtcctctacaa 1381 ggatgacatgggggtgcccaccctcaagtaccattacgagggcatgagcgtggcagagtg 1441 tgggtgcaggtagtatctgcctgcggggctggggaggcaggccaaaggggctccacatga 1501 gaggtcctgcatgcccctgggcacaacaaggactgattcaatctgcatgccagcctggag 1561 gaggaaagggagcctgctctccctccccacaccccacccaaagcatacaccgctgagctc 1621 aactgccagggaaggctaaggaaatggggatttgagcacaacaggaaagcctgggagggt 1681 tgttgggatgcaaggaggtgatgaaaaggagacagggggaaaaataatccatagtcagca 1741 gaaaacaacagcagtgagccagaggagcacaggcgggcaggtcactgcagagactgatgg 1801 aagttagagaggtggaggaggccagctcgctccaaaacccttggggagtagagggaagga 1861 gcaggccgcgtgtcacacccatcattgtatgttatttcccacaacccagttggaggggca 1921 tggcttccaatttagagacc cg