yan
Uploaded by
40 SLIDES
643 VIEWS
410LIKES

Section Outline

DESCRIPTION

Section Outline. Chapter 10 Cell Division 10–1 Cell Growth A. Limits to Cell Growth 1. DNA “Overload” 2. Exchanging Materials 3. Ratio of Surface Area to Volume 4. Cell Division 10–2 Cell Division A. Chromosomes B. The Cell Cycle C. Events of the Cell Cycle D. Mitosis

1 / 40

Download Presentation

Section Outline

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Section Outline Chapter 10 Cell Division 10–1 Cell Growth A. Limits to Cell Growth 1. DNA “Overload” 2. Exchanging Materials 3. Ratio of Surface Area to Volume 4. Cell Division 10–2 Cell Division A. Chromosomes B. The Cell Cycle C. Events of the Cell Cycle D. Mitosis Prophase; 2. Metaphase; 3. Anaphase; 4. Telophase Cytokinesis 11/18/09 Section 10-2

  2. Cell wall Origin of replication Binary Fission Plasma membrane In binary fission, the chromosome replicates (beginning at the origin of replication), and the two daughter chromosomes actively move apart E. coli cell Bacterial chromosome Two copies of origin Prokaryotes (bacteria and archaea) reproduce by a type of cell division called binary fission Origin Origin

  3. Cell division results in geneticallyidentical daughter cells Fig. 12-2 (b) Most cell division results in daughter cells with identical genetic information, DNA (Mitosis) 20 µm 100 µm 200 µm (a) Reproduction (b) Growth and development (c) Tissue renewal A special type of division (Meiosis) produces non-identical daughter cells (gametes, or sperm and egg cells)

  4. The sex chromosomes are called X and Y Human females have a homologous pair of X chromosomes (XX) Human males have one X and one Y chromosome The 22 pairs of chromosomes that do not determine sex are called autosomes Which one is male? Which one is female? • Each pair of homologous chromosomes includes one chromosome from each parent • The 46 chromosomes in a human somatic cell are two sets of 23: one from the mother and one from the father • A diploid cell (2n) has two sets of chromosomes • For humans, the diploid number is 46 (2n = 46)

  5. Fig. 12-4 Chromosomes 0.5 µm DNA molecules Chromo- some arm Chromosome duplication (including DNA synthesis) Before cell division, chromosomes must replicate Centromere Sister chromatids Separation of sister chromatids Centromere Sister chromatids

  6. Interphase (about 90% of the cell cycle) can be divided into: Fig. 12-5 INTERPHASE S (DNA synthesis) G1 Cytokinesis G2 Mitosis MITOTIC (M) PHASE The cell grows during all three phases, but chromosomes are duplicated only during the S phase

  7. Fig. 12-6b Prophase G2 of Interphase Prometaphase Chromatin (duplicated) Centrosomes (with centriole pairs) Early mitotic spindle Fragments of nuclear envelope Centromere Aster Nonkinetochore microtubules Kinetochore Nuclear envelope Plasma membrane Chromosome, consisting of two sister chromatids Kinetochore microtubule Nucleolus

  8. Fig. 12-6d Telophase and Cytokinesis Metaphase Anaphase Nucleolus forming Metaphase plate Cleavage furrow Daughter chromosomes Nuclear envelope forming Centrosome at one spindle pole Spindle

  9. Division in meiosis I occurs in four phases: Telophase I and Cytokinesis Prophase I Metaphase I Anaphase I Centrosome (with centriole pair) Sister chromatids remain attached Centromere (with kinetochore) Sister chromatids Chiasmata Spindle Metaphase plate Cleavage furrow Homologous chromosomes separate Homologous chromosomes Microtubule attached to kinetochore Fragments of nuclear envelope

  10. Fig. 13-8d • Division in meiosis II also occurs in four phases: Telophase II and Cytokinesis Metaphase II Prophase II Anaphase II Sister chromatids separate Haploid daughter cells forming • Meiosis II is very similar to mitosis

  11. Fertilization and meiosis alternate in sexual life cycles A life cycle is the generation-to-generation sequence of stages in the reproductive history of an organism 46 46 46 46 23 46 23 One set Two sets of chromosomes

  12. CHAPTER 11 INTRODUCTION TO GENETICS 11–1 The Work of Gregor Mendel 11–2 Probability and Punnett Squares 11–3 Exploring Mendelian Genetics Mendel’s Genetic Principles Other modes of Inheritance Genes and the Environment 11–4 Meiosis & Sexual Reproduction

  13. 11–1 The Work of Gregor Mendel • Gregor Mendel’s Peas: Secrets of Mendel’s success • Choosing the right organism to work withDesigning and performing the experiment correctlyAnalyzing the data properly Haploid,1n • Homologous chromosomes • For each characteristic, an organism inherits two alleles, one from each parent. They may be the same allele (homozygous, e.g., AA or aa) or different alleles (heterozygous, e.g., Aa). Diploid, 2n

  14. B. Genes and Dominance • C. The Law of Segregation • 1. The F1 Cross: P – parent generation; F1: first generation. • 2. Explaining the F1 Cross Seed Shape Seed Color Seed Coat Color Pod Shape Pod Color Flower Position Plant Height Round Yellow Gray Smooth Green Axial Tall RR rr YY yy GG gg Wrinkled Green White Constricted Yellow Terminal Short Round Yellow Gray Smooth Green Axial Tall • If the 2 alleles of an inherited pair differ • Then one determines the organism’s appearance and is called the dominant allele (use Capital symbols, e.g., RR) • The other allele has no noticeable effect on the organism’s appearance and is called the recessive allele (use lower case symbols, e.g., rr)

  15. Trait—A variable characteristic of organism. Phenotype: how we look/behave. Doesn’t always represent genotype. • Genotype: what our genes say. Alleles: Different molecular forms of a gene. Arise through mutation. Diploid cell has a pair of alleles at each locus. Alleles on homologous chromosomes may be same or different. P generation  Purple flowers White flowers All plants havepurple flowers F1 generation Fertilizationamong F1 plants(F1 F1) F2 generation 3 4 of plantshave purple flowers Conventions for alleles: P, the dominant (purple) allele, and p, the recessive (white) allele. P generation: parent generation; their gametes: P and p; F1 generation: first generation. Pp. F2 generation: second generation. 1 4 of plants have white flowers

  16. P generation (true-breedingparents)  White flowers Purple flowers All plants havepurple flowers F1 generation Fertilizationamong F1 plants(F1 F1) 3 4 1 4 of plantshave white flowers of plantshave purple flowers F2 generation PP pp Pp x Pp • 11–2 Probability and Punnett Squares • A. Genetics and Probability • B. Punnett Squares • C. Probability and Segregation • D. Probabilities Predict Averages pp Pp Pp PP

  17. Mendel’s law of segregation • Predicts that allele pairs separate from each other during the production of gametes. That is, a sperm or egg carries only one allele for each characteristic because the allele pairs segregate from each other during gamete production. Pp x Pp The Punnett square is used to keep track of the gametes (two sides of the square) and offspring (cells within the square) Homozygous dominant (PP), homozygous recessive (pp), and heterozygous (Pp) refer to the genotype (the nature of the genes as inferred from observations and knowledge of how the system works). The phenotype is what we see (expressed traits). Gamete genotype for F1 Gamete genotype for F1

  18. Monohybrid Cross MaleFemale % F1 Purple (P/) PP x PP _____ PP x pp _____ pp x pp _____ PP x Pp _____ pp x Pp _____ Pp x Pp _______ 1 2 3 4 5 6

  19. 11–3 Exploring Mendelian Genetics • A. Independent Assortment • 1. The Two-Factor Cross: F1 • 2. The Two-Factor Cross: F2 • B. A Summary of Mendel’s Principles Mendel’s law of independent assortment States that alleles of a pair segregate independently of other allele pairs during gamete formation Mendel tried to determine how two characteristics were inherited by tracking two characteristics at once

  20. 11–3 Exploring Mendelian Genetics • C. Beyond Dominant and Recessive Alleles • 1. Incomplete Dominance • 2. Codominance (ABO blood type) • 3. Multiple Alleles • 4. Polygenic Traits • D. Applying Mendel’s Principles • E. Genetics and the Environment Polygenic inheritance A single characteristic may be influenced by many genes -- creates a continuum of phenotypes, e.g., skin color and height.

  21. Human ABO Blood GroupA Case of Co-dominance Type Genotype RBCs Anti-bodies Re-ceives Donates Freq A AA or AO B A or O A or AB 40% B BB or BO A B or O B or AB 10% AB AB Neither AB, A,B, O(universal) AB(universal) 4% O OO Both O O,AB,A,B(universal) 46%

  22. Many inherited disorders in humans are controlled by a single gene. Some autosomal disorders in humans

  23. The environmental effects many characteristics Many traits are affected, in varying degrees - By both genetic and environmental factors - “nature versus nurture” - Identical twins that are easily distinguished. Environmental influences are not passed on the next generation. Genetic testing can detect disease-causing alleles Diagnostic testing is used to confirm or rule out the existence of a genetic disorder. This procedure can be used on the unborn (prenatal testing or pre-implantation testing) as well as after birth (particularly adults). This type of testing is designed to identify a person predisposed to certain disorders such as colon cancer or breast cancer (BRCA1 or BRCA2). Ethical, moral, and medical issues

  24. Chapters 12, 13 and 14 0 Molecular Biology of the Gene How Genes are Regulated? The Frontier of Biotechnology The Human Genome

  25. What is a chromosome, DNA molecule, and a gene? • 22 pairs (autosomes) + XX • or XY (sex chromosome) = 46 • One of each pair donated from each parent’s egg or sperm • Each chromosome contains a few hundred or a few thousand genes • Smallest chromosome Y = ~59 million base pairs (bp) • largest chromosome #1 = ~263 million bp • Each pair is a base pair • Remember the basic unit of DNA • mononucleotide consists of a • Phosphate, a ribose, & a N base.

  26. 2nm diameter overall Structure of DNA 0.34 nm between each pair of bases Rosalind Franklin’s Concluded that DNA was some sort of helix in 1953, Watson and Crick cracked the genetic code by showing how N base, P, and sugar are configured 3.4 nm length of each full twist of helix

  27. DNA ATGC Codon Gene Chromosome genome English Abcdefghij ….xyz Word Sentence Chapter Book DNA is Information

  28. The human genome has 3.1 billion letters like this. A typical gene looks like this: 1 accatttgttggcagagacagatggtcagtctggaggatg acgtggcgtg aacatctgcc 61 tggagtcccg cccctgccca gaacccttcc tgagacctcg ccggccttgt tttattcaaa 121 gacagagaag accaaagcat tgcctgccag agctttgttt tatatattta ttcatctggg 181 aggcagaaca ggcttcggac agtgcccatg caatggcttg ggttgggatt ttggtttctt 241 cctttcctgt gaaggataag agaaacaggc ccggggggac caggatgaca cctccatttc 301 tctccaggaa gttttgagtt tctctccacc gtgacacaat cctcaaacat ggaagatgaa 361 agggcagggg atgtcaggcc cagagaagca agtggctttc aacacacaac agcagatggc 421 accaacggga ccccctggcc ctgcctcatc caccaatctc taagccaaac ccctaaactc 481 aggagtcaac gtgtttacct cttctatgca agccttgcta gacagccagg ttagcctttg 541 ccctgtcacc cccgaatcat gacccaccca gtgtctttcg aggtgggttt gtaccttcct 601 taagccagga aagggattca tggcgtcgga aatgatctgg ctgaatccgt ggtggcaccg 661 agaccaaact cattcaccaa atgatgccac ttcccagagg cagagcctga gtcaccggtc 721 acccttaata tttattaagt gcctgagaca cccggttacc ttggccgtga ggacacgtgg 781 cctgcaccca ggtgtggctg tcaggacacc agcctggtgc ccatcctccc gacccctacc 841 cacttccatt cccgtggtct ccttgcactt tctcagttca gagttgtaca ctgtgtacat 901 ttggcatttg tgttattatt ttgcactgtt ttctgtcgtg tgtgttggga tgggatccca 961 ggccagggaa agcccgtgtc aatgaatgcc ggggacagag aggggcaggt tgaccgggac 1021 ttcaaagccg tgatcgtgaa tatcgagaac tgccattgtc gtctttatgt ccgcccacct 1081 agtgcttcca cttctatgca aatgcctcca agccattcac ttccccaatc ttgtcgttga 1141 tgggtatgtg tttaaaacat gcacggtgag gccgggcgca gtggcctcac gcctgtaatc accatttgttggcagagacagatggtcagt Peter atcatttgttggcagagacagatggtcagt Paul Each 3-letter word codes for a codon

  29. Two Ambitions of DNA • 1. Replication • 2. To make proteins (workers in the cell) • What are involved in making proteins? • DNA is the information molecule (the genetic code). The code needs to be transcribed into the RNA language. mRNA (containing codons) goes to the protein synthetic factory (ribosomes containing rRNA) • The 20 different type of amino acids in the cytoplasm are picked up by their designated tRNAand become its cargo • tRNA with “anticodon” will find its partner codon and starts the zipper up process, so amino acids will be lined up in the order specified by the genetic code. A protein is born.

  30. What is DNA Replication? When does DNA replicate?Cell reproduction DNA replication follows the base pairing rule. Each parent strand remains intact Every DNA molecule is half “old” and half “new”: semi-conservative replication new old old new

  31. DNA  DNA Replication DNA Template: ATCGGCCATDNAReplicate:TAGCCGGTA DNA  RNA Transcription DNA Template:ATCGGCCATRNATranscript: UAGCCGGUA

  32. Controls in Eukaryotic Cells: atdifferent stages Most Genes Are Turned Off • Controls of transcription • Transcript-processing controls • Controls over translation • Controls following translation Cells of a multi-cellular organism rarely use more than 5–10 percent of their genes at any given time The remaining genes are selectively expressed Cell differentiation starts in the embryo

  33. Recombinant DNA technology Insert e.g., human insulin gene

  34. 10.16 Mutations can change the meaning of genes • Mutations are changes in the DNA base sequence caused by errors in DNA replication or recombination, or by mutagens, resulting in the replacement of one amino acid for another in a polypeptide sequence Base-pair substitutions Insertions Deletions Frame shift

  35. 2N The Making of Dolly

  36. Gene Therapy in Humans

  37. Analyzing DNA Fingerprints Load test samples here Mother Baby Male 1 Male 2 Male 3 DNA is stained or made visible by use of a radioactive probe Pattern of bands is used to • Identify or rule out criminal suspects • Identify bodies • Determine paternity

  38. Questions about the Human Genome • What is the size of the human genome? • Why is it so important to sequence the human genome? • Why is it important to sequence genomes of other species? • How many genes do we have? • What do we learn from our genome? • How does sequencing of the human genome benefit humanity? • How are our genes related to diseases? How many disease do humans have? • What are some important ethical questions that we must address?

More Related