who wrote shakespeare application of multi disciplinary research to medicine and humanity n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Who Wrote Shakespeare? Application of Multi-Disciplinary Research to Medicine and Humanity PowerPoint Presentation
Download Presentation
Who Wrote Shakespeare? Application of Multi-Disciplinary Research to Medicine and Humanity

Loading in 2 Seconds...

play fullscreen
1 / 48

Who Wrote Shakespeare? Application of Multi-Disciplinary Research to Medicine and Humanity - PowerPoint PPT Presentation


  • 79 Views
  • Uploaded on

Who Wrote Shakespeare? Application of Multi-Disciplinary Research to Medicine and Humanity. Albert C.-C. Yang, M.D., PhD Attending Physician, Department of Psychiatry, Taipei Veterans General Hospital, Taiwan Assistant Professor, School of Medicine, National Yang-Ming University, Taiwan.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Who Wrote Shakespeare? Application of Multi-Disciplinary Research to Medicine and Humanity' - xiu


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
who wrote shakespeare application of multi disciplinary research to medicine and humanity

Who Wrote Shakespeare?Application of Multi-Disciplinary Research to Medicine and Humanity

Albert C.-C. Yang, M.D., PhD

Attending Physician, Department of Psychiatry,

Taipei Veterans General Hospital, Taiwan

Assistant Professor, School of Medicine,

National Yang-Ming University, Taiwan

accyang@gmail.com

information created by biological systems
Information Created by Biological Systems

Neuronal Impulse

Genetic Codes

human creations
Human Creations

Earliest record of paintings by human

Lascaux Cave France 20000 BC

human creations1
Human Creations

Symbols

Indus script

India 3500 BC

Jiahu

China 6600 BC

Vinča signs

Europe 4500 BC

human creations2
Human Creations

Writing Systems

Cuneiform scriptSumerians Iraq 2600 BC

challenge

Human Genome vs. Chimpanzee Genome

Challenge

How to effectively categorize information of different origins?

A general principle to analyze

information-embedded signals

Repetitive Patterns

information categorization method
Information Categorization Method

Comparison of human literary texts

Repetitive patterns: words

rank comparison maps
Rank Comparison Maps

Shakespeare vs. Shakespeare

Shakespeare vs. Fletcher

rank comparison maps1
Rank Comparison Maps

金庸vs. 古龍

金庸 vs. 金庸

射雕英雄傳

楚留香傳奇

倚天屠龍記

information based similarity index
Information-Based Similarity Index

Physical Review Letters 90:108103 (2003);

Physica A 329:473-483 (2003);

Journal of Computational Biology 12(8):1103-16 (2005).

chinese authorship debate
Chinese Authorship Debate

Dream of the Red Chamber

dream of red chamber
Dream of Red Chamber 紅樓夢
  • One of China's four great classical novels.
  • Written by Cao Xueqin in the middle of the 18th century during the early Qing Dynasty.
  • 80 Chapters in original manuscript copies.
  • Gao E and Cheng Weiyuan added 40 additional chapters to complete the novel.
who wrote shakespeare s plays
Who Wrote Shakespeare’s Plays?
  • Both Marlowe and Shakespeare had births recorded in 1564.
  • Before Shakespeare’s name became widely known, Marlowe had already produced several major works in various genres, including Tamburlaine the Great and Dr. Faustus.
  • Marlowe’s career tragically ended on 30 May, 1593 when he was apparently murdered in a dispute.
the murder of the man who was shakespeare calvin hoffman
The Murder of The Man Who Was Shakespeare – Calvin Hoffman
  • Shakespeare did not visit some places which vividly appeared in scenes of Shakespeare’s plays.
  • Shakespeare seems to suddenly appear after Marlowe’s death.
  • Marlowe had not died as claimed in 1593, but instead escaped to a secret refuge in Italy where he spent the rest of his life writing the body of plays generally attributed to Shakespeare.
slide24

Henry VIII

The Two Noble Kinsmen

Edward III

Yang AC et al. Physica A 329:473-483 ( 2003)

slide28

Critique

It is like taking all the words and throwing them in the blender

~ leading Shakespeare scholar

Support

The Calvin & Rose G. Hoffman Marlowe Memorial Trust 2003 Prize

~ leading Shakespeare scholar

slide31

仿倪匡作品

倪匡原作

heart rate dynamics
Heart rate dynamics

Parasympathetic stimulation

Sympathetic stimulation

which heart rate pattern is healthy
Which Heart Rate Pattern is Healthy?

Heart Failure

Heart Failure

Normal

Atrial Fibrillation

technical challenges
Technical Challenges
  • How to map a heart rate time series to a symbolic sequence?

KJLFNHACUARAFVTHTYAERFVVAEVACVAZCFVDFVZDSDSFVSDFVNTEWOSIXWRXDPOIJRROIRFUFNVIMVMF

?

  • How to define wordsin heart rate symbolic sequences?

KJ LFN HACUA RAFVT HTY AER FV VA EVAC VAZ CF VDF VZ D SDSFV SDFV NTEWOSI XW RXDP OIJR RO IRFU FNV IMV MF

?

symbolic mapping
Symbolic Mapping

8-bit word: 11000110, 10001100, 00011001

comparison of human heartbeat

Health vs. Disease

D = 0.25

Comparison of Human Heartbeat

Health vs. Health

D = 0.10

Yang AC et al. Physical Review Letter 90: 108103 (2003)

phylogenetic tree of human heartbeat
Phylogenetic Tree of Human Heartbeat

Yang AC et al. Physical Review Letter 90: 108103 (2003)

clustering of human heartbeat is associated with 2 ar gene polymorphisms
Clustering of Human Heartbeat Is Associated with β2-AR Gene Polymorphisms

Yang AC et al. PLoS ONE 6(5): e19232 (2011)

application to genetic sequences
Application to Genetic Sequences

Picture obtained from www.genetic-programming.org

slide42

Analogy to Natural Languages

ACTTAAGTACCTTATCTATCTACAGATAGAAAAGTTGCTTTTTAGACTTTGTGTCTACTTTTCTCAACTA

AACGAAATTTTTGCTATGGCCGGCATCTTTGATGCTGGAGTCGTAGTGTAATTGAAATTTCATTTGGGTT

GCAACAGTTTGGAAGCAAGTGCTGTGTGTCCTAGTCTAAGGGTTTCGTGTTCCGTCACGAGATTCCATTC

TACAAACGCCTTACTCGAGGTTCCGTCTCGTGTTTGTGTGGAAGCAAAGTTCTGTCTTTGTGGAAACCAG

TAACTGTTCCTAATGGCCTGCAACCGTGTGACACTTGCCGTAGCAAGTGATTCTGAAATTTCTGCAAATG

GCTGTTCTACTATTGCGCAAGCCGTCCGCCGTTATAGCGAGGCCGCTAGCAATGGTTTTAGGGCATGCCG

ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTAAACGA

ACTTTAAAATCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAA

TTTTACTGTCGTTGACAAGAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTTCGTCCGTGT

TGCAGTCGATCATCAGCATACCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTTC

TTGGTGTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTCCTTCAGGTTAGAGACGTGCTAGTGCG

TGGCTTCGGGGACTCTGTGGAAGAGGCCCTATCGGAGGCACGTGAACACCTCAAAAATGGCACTTGTGGT

Similarity

Similarity

dna words
DNA “Words”

5’

3’

TACCCCCACTGTCAACCCAACACAGGCATG……

rank comparison maps2
Rank Comparison Maps

Same Species

Different Species

human influenza virus
Human Influenza Virus

Our result is consistent with previous finding based on sequence alignment technique (Science 1986; 232: 980)

genome wide sequence comparison sars coronavirus
Genome-wide Sequence Comparison (SARS Coronavirus)

Yang AC et al. Journal of Computational Biology 12(8):1103-16 (2005).

slide47

Mathematics compares the most diverse phenomena and discovers the secret analogies that unite them

- Joseph Fourier

selected references and tutorial
Selected References and Tutorial
  • 1. Yang AC, Hseu SS, Yien HW*, Goldberger AL, Peng CK. Linguistic analysis of human heartbeats using frequency and rank order statistics. Physical Review Letters 90:108103 (2003).
  • 2. Yang AC, Peng CK, Yien HW, Goldberger AL. Information categorization approach to literary authorship disputes. Physica A 329:473-483 ( 2003).
  • 3. Yang AC, Goldberger AL, Peng CK.* Genomic classification using an information-based similarity index: application to the SARS coronavirus. Journal of Computational Biology 12(8):1103-16 (2005).
  • 4. Peng CK, Yang AC , Goldberger AL. Statistical physics approach to categorize biologic signals: from heart rate dynamics to DNA sequences. Chaos 17: 015115 (2007).
  • 5. Yang AC, Tsai SJ, Hong CJ, Wang C, Chen TJ, Liou YJ, Peng CK. Clustering heart rate dynamics is associated with β-adrenergic receptor polymorphisms: analysis by information-based similarity index. PLoS ONE 6(5): e19232 (2011).

Online Tutorial: http://www.physionet.org/physiotools/ibs/

Physionet: NIH Research Resource for Complex Physiologic Signals