1 / 16
Download Presentation

Group 4 Data

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Group 4 Data Diane Meas The 3 A-Michaels (get it??) 3 amigos… a-michaels….

  2. A. baumannii def • Gene name: Zinc (II) binding peptide deformylase 1 • Sequence: ATGGCCTTATTACCTATTTTAAGTTTTCCTGATCCCCGTCTTCGTACCATTGCTAAGCCCGTTGAAGAAGTTACTGATGAAATTCGTCAACTTGCAGCAGATATGTTTGAAACCATGTATGCGGCACCAGGTATCGGTTTAGCAGCTTCTCAGGTCGATCGTCATATTCAGCTTATCGTCATGGATTTGTCTGAATCTAAAGATGAACCTATGGTTTTCATTAACCCCAAAGTAACTCCGCTGACTGAAGAGACGCAGCCGTACGAAGAAGGCTGTCTATCAGTGCCACAAATATACGACAAAGTTGATCGCCCGTCACGCGTGAAAATTGAGGCAATTAACCTTGAAGGTCAAGCATTTGAGATAGAAGCTGACGGACTTCTCGCTGTTTGTATCCAACATGAAATGGATCACTTAAATGGCAAATTGTTTGTGGATTATTTGTCGCCACTTAAGCGTCAGCGTGCGCGTGAAAAAGTCGAAAAAATTGTTCGCCAACGCGAACGTGAAAAAGTTGCGGTAAAACGTTAA

  3. A. Baumannii def • Amino Acid Sequence • MALLPILSFPDPRLRTIAKPVEEVTDEIRQLAADMFETMYAAPGIGLAASQVDRHIQLIVMDLSESKDEPMVFINPKVTPLTEETQPYEEGCLSVPQIYDKVDRPSRVKIEAINLEGQAFEIEADGLLAVCIQHEMDHLNGKLFVDYLSPLKRQRAREKVEKIVRQREREKVAVKR

  4. Primer Design • Forward Primer: • 5’-GACGACGACAAGATGGCCTTATTACCTATTTTAAGTTTTCCT-3’ • Tm = 59°C • Primer name: Gp4Abdef_F • In red: Forward LIC tail • Reverse Primer: • 5’-GAGGAGAAGCCCGGTTAACGTTTTACCGCAACTTTTTC-3’ • Tm = 58°C • Primer name: Gp4Abdef_R • In blue: Reverse LIC tail

  5. PCR: A. baumannii def gene Figure 1. (a) PCR of Acinetobacter baumanniidef gene using LIC primers. The expected product size is 561 bp. Lane 1: A. baumannii A1; Lane 2: A. baumannii A2; Lane 4: GeneRuler™ 1kb DNA Ladder; Lane 5: A. baumannii B1; Lane 6: A. baumannii B2; Lane 8: 100 kb ladder; Lanes 3 and 7 are empty. (b) GeneRuler™ 1kb DNA Ladder band sizes. 1 2 3 4 5 6 7 8 (a) (b) 5000 1500 500

  6. Restriction Digest with BglII and BamHI Figure 2. Double restriction digest of A. baumanniidef PCR products using BglII and BamHI. The expected results were two bands at 561 bp and 5000 bp corresponding to the insert and vector sizes respectively. Our results show one band at approximately 6 kb for Lanes 2 and 3. Lane 1 & 4: GeneRuler™ 1kb DNA Ladder; Lane 2: Ab Def Clone 1 (~6 kb); Lane 3: Ab Def Clone 2 (~6kb). 1 2 3 4 5000 1500 500

  7. Restriction Digest with BglII and BamHI for Ab Def 3 to 8 1 2 3 4 5 6 7 8 Figure 3. Double restriction digest with BglII and BamHI for Ab Def clones 3 to 8. Lanes 1 and 5: GeneRuler™ 1kb DNA Ladder. Lane 2: Ab Def Clone 3 (~6kb); Lane 3: Ab Def Clone 4 (~6kb); Lane 4: Ab Def Clone 5 (~6kb); Lane 6: Ab Def Clone 6 (~6kb); Lane 7: Ab Def Clone 7 (~6kb); Lane 8: Ab Def Clone 8 (~6kb). 5000 1500 500

  8. Restriction Digest with HincII 1 2 3 4 5 6 Figure 4. Acinetobacter baumannii def clones 1 and two were digested using the restriction endonuclease HincII. We expect 3 bands at approximately 3921, 1556, and ~500 bp. After visualization with ethidium bromide staining, we see a bands at ~6000 bp, 4000 bp, 1500 bp for Ab def clone 1. For Ab def 2, we see bands at ~6000 bp, 4000 bp, 15000 bp, and a very faint band at 500 bp. Lanes 1 and 6: GeneRuler™ 1kb DNA ; Lane 2: Ab Def clone 1; Lane 5: Ab Def clone 2; lanes 3 and 4 are empty. 5000 1500 500

  9. Group 4: Restriction Digest of TR-45, 46, 49, 50, 53, 54, 57, 58 with BamHI, and Double Digests of Ab Def 1, 2, 3, and 4 with BglII and BamHI Figure 5. Restriction digests of TR-45, 46, 49, 50, 53, 54, 57, and 58 with BamHI and double digests of Ab Def 1, 2, 3, and 4 with BglII and BamHI. The TR clones all show two bands at approximately 4kb and 1.2 kb. All of the Ab Def clones double digests show a single band at approximately 5.5kb. The Ab def clones do not appear to be cut by the two enzymes. Lanes 1, 8, 9, 16: GeneRuler™ 1kb DNA Ladder; Lane 2: TR-45; Lane 3: TR-46; Lane 4: TR-49; Lane 5: TR-50; Lane 6: TR-53; Lane 7: TR-54; Lane 10: TR-57; Lane 11: TR-58; Lane 12: Ab Def 1 Double Digest (DD) #2; Lane 13: Ab Def 2 DD #2; Lane 14: Ab Def 3 DD #2; and Lane 15: Ab Def 4 DD #2 . 1 2 3 4 5 6 7 8 ~4kb ~1.2kb 9 10 11 12 13 14 15 16 ~4kb ~1.2kb

  10. Group 4: Restriction Digest of TR-45 to TR-55 with BamHI Figure 6. Restriction digest of TR-45 to TR-55 clones with BamHI. All TR clones show a two bands at approximately 4kb and 1.2 kb. Lane 1: GeneRuler™ 1kb DNA Ladder; Lane 2: TR-45; Lane 3: TR-46; Lane 4: TR-47; Lane 5: TR-48; Lane 6: TR-49; Lane 7: TR-50; Lane 8: TR-51; Lane 9: TR-52; Lane 10: TR-53; Lane 11: TR-54; and Lane 12: TR-55. 1 2 3 4 5 6 7 8 9 10 11 12 5000 1500 500

  11. Group 4: Restriction Digest of TR-56 to TR-65 with BamHI and Double Digest of Ab Def 2 with BglII and BamHI 1 2 3 4 5 6 7 8 9 10 11 12 Figure 7. Restriction digest of TR-56 to TR-65 with BamHI and double digest of Ab Def clone 2 (overnight) with BglII and BamHI. The TR clones all have two bands at approximately 4kb and 1.2 kb. Ab def clone 2 shows a band at approximately 5kb and 500 bp. Lane 1: TR-56; Lane 2: TR-57; Lane 3: TR-58; Lane 4: GeneRuler™ 1kb DNA Ladder; Lane 5: TR-59; Lane 6: TR-60; Lane 7: TR-61; Lane 8: TR-62; Lane 9: TR-63; Lane 10: TR-64; Lane 11: TR-65; and Lane 12: Ab Def 2 Double Digest #3 with BglII and BamHI. 5000 1500 500

  12. Group 4: SDS gel of His-tag Protein Overexpression and Purification of AbFabI and AbDef Figure 8. SDS gel of His-tag protein overexpression and purification of AbFabI and AbDef. For AbFabI we expect a band at ~35.5 kDa and for AbDef we expect a band at ~24.6 kDa. • Lanes 1 and 6: Perfect Protein™ Markers 10-225 kDa; Lane 2: Group 4 AbDef (5 hour induction) 10 µl sample + 10 µl 2x SDS loading dye; Lane 3: group 4 AbDef (5 hour induction) 20 µl sample + 20 µl 2x SDS loading dye; Lane 4: AbFabI (overnight induction) 10 µl sample + 10 µl 2x SDS loading dye; and Lane 5: AbFabI (overnight induction) 20 µl sample + 20 µl 2x SDS loading dye. • Perfect Protein™ Markers 10-225 kDa protein size determination. (a) 1 2 3 4 5 6 (b) kDa 225 50 35 25 10

  13. Group 4: SDS gel of EcFabI overexpressed His-tag protein (large scale 250 ml culture) Figure 9. His-tagged EcFabI protein overexpression (large scale) SDS gel. We expect an overexpressed band at approximately 32.3 kDa. Lane 1: EcFabI (15 µl protein extract + 15 µl 2x SDS loading dye); Lane 2: 5 µl of Perfect Protein™ Markers 10-225 kDa. 1 2 kDa 225 50 35 25 10

  14. Group 4: SDS gel of His-tagged protein overexpression of AbFabI crude protein extract and EcFabI affinity column purification Figure 10. SDS gel of AbFabI crude protein extract and EcFabI flow through, wash, and elute. Expected protein bands for AbFabI is ~35.5 kDa and for EcFabI is ~32.3 kDa. Lane 1: AbFabI crude extract (15 µl sample + 15 µl 2x SDS loading dye); Lane 2: empty; Lane 3: Perfect Protein™ Markers 10-225 kDa; Lane 4: EcFabI flow through 1; Lane 5: Ec FabI wash 1; Lane 6: EcFabI Elute 1; Lane 7: empty; Lane 8: Perfect Protein™ Markers 10-225 kDa. 1 2 3 4 5 6 7 8 kDa 225 50 35 25 10

  15. SDS gel of His-tagged protein overexpression of E. coli and A. baumannii FabI “Elute” Fraction Figure 11. SDS PAGE gel of EC FabI (large scale) and AB FabI Elute. Expected band for EC FabI is ~32.3 kDa while AB FabI is ~35.5 kDa. Lane 1: Ec FabI Elute 2. Lane 2: Ec FabI Elute 3. Lane 3: Ec FabI Strip. Lanes 4 and 5: Empty. Lane 6: Perfect Protein™ Markers 10-225 kDa. Lane 7: Ab FabI Elute 1. Lanes 1 to 3 are from the 250 ml culture scale up. Lanes 1 to 3 shows a distinct band at ~35 kDa, which will correlate with our gene. It also contains at ~75 kDa of unknown origin. There was no significant over expression in the AB FabI gene (Lane 7) 1 2 3 4 5 6 7 kDa 225 50 35 25 10

  16. SDS-PAGE of EcFabI small scale protein extraction and purification Figure 12. SDS-PAGE of small scale E. coli fabI protein extraction and purification. Lane 1: Perfect Protein™ Markers 10-225 kDa; Lane 2: EcFabI crude extract; Lane 3: EcFabI flow through fraction; Lane 4: EcFabI Wash fraction; Lane 5: Ec FabI Elute; Lane 6: EcFabI Strip fraction 1 2 3 4 5 6 kDa 225 50 35 25

More Related