EIWITSYNTHESE - PowerPoint PPT Presentation

trish
eiwitsynthese n.
Skip this Video
Loading SlideShow in 5 Seconds..
EIWITSYNTHESE PowerPoint Presentation
Download Presentation
EIWITSYNTHESE

play fullscreen
1 / 40
Download Presentation
255 Views
Download Presentation

EIWITSYNTHESE

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. EIWITSYNTHESE

  2. De cel: bouwsteen van het leven OOG HERSENEN DARM LEVER HUID BLOED

  3. Hetzelfde DNA in elke cel

  4. De cel membraan kern organellen

  5. DNA Cel Kern Chromosomen Gen DNA-molecuul (chromosoom)


  6. De bouwstenen van DNA Gen Chemische basen DNA-molecuul (chromosoom) A T C G

  7. DNA  RNA  eiwit Celmembraan DNA Kern Aminozuur-keten (= eiwit) DNA basen mRNA Gen eiwit Ribosoom

  8. Eiwitsynthese DNA >>>>>>> m-RNA>>>>>>> eiwit Transcriptie speelt zich af in de kern Translatie speelt zich af in het cytoplasma

  9. Benodigdheden DNA TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA m-RNA-polymerase  Knipenzym X Knipenzym Y

  10. Waterstofbruggen worden verbroken. 3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld. TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA

  11. m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces. AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA ATGGTATGAATATATACGAAAACACCCTTAA

  12. AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA ATGGTATGAATATATACGAAAACACCCTTAA

  13. TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA ATGGTATGAATATATACGAAAACACCCTTAA

  14. TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA primair messenger-RNA AUGGUAUGAAUAUAUACGAAAACACCGUUAA

  15. DNA TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA primair messenger-RNA AUGGUAUGAAUAUAUACGAAAACACCGUUAA

  16.  Splicing primair messenger-RNA Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Zo wordt primair messenger-RNA het uiteindelijke messenger-RNA. AUGGUAUGAAUAUAUACGAAAACACCGUUAA

  17. primair messenger-RNA Exon Exon = Expressed region AUGGUA UAUAUACGAAAACACCGUUAA UGAA Intron

  18. messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden(nucleotide = ribose + fosfaat + organische base). AUGGUACGAAAACACCGUUAA De organische basen zijn:U: uracil (i.p.v. thymine bij DNA)A: adenineG: guanineC: cytosine

  19. Translatie Translatie: vertaling van m-RNA tot eiwit. Hoe worden eiwitten gemaakt?

  20. RF GCU UAC CAU GCA GUG UUU Benodigdheden m-RNA Codon Codon Codon Codon Codon Codon Codon AUG GUA CGA AAA CAC CGU UAA RF = Release Factor Anti-codon t-RNA ribosoom Aminozuur 30 S 50 S

  21. Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan. AUG GUA CGA AAA CAC CGU UAA UAA = stopcodon Arginine Histidine Lysine Arginine Valine Methionine AUG = startcodon

  22. AUG = startcodon UAC CAU Met Val AUG GUA CGA AAA CAC CGU UAA Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit.

  23. UAC CAU Val Met AUG GUA CGA AAA CAC CGU UAA

  24. UAC CAU AUG GUA CGA AAA CAC CGU UAA Val Met

  25. GCU UAC CAU Arg AUG GUA CGA AAA CAC CGU UAA Val Met

  26. GCU UAC CAU AUG GUA CGA AAA CAC CGU UAA Arg Val Met

  27. GCU UAC CAU Lys UUU AUG GUA CGA AAA CAC CGU UAA Arg Val Met

  28. GCU UAC CAU UUU AUG GUA CGA AAA CAC CGU UAA Lys Arg Val Met

  29. GCU UAC CAU His GUG UUU AUG GUA CGA AAA CAC CGU UAA Lys Arg Val Met

  30. GCU UAC CAU GUG UUU AUG GUA CGA AAA CAC CGU UAA His Lys Arg Val Met

  31. GCU UAC CAU Arg GCA GUG UUU AUG GUA CGA AAA CAC CGU UAA His Lys Arg Val Met

  32. GCU UAC CAU GCA GUG UUU AUG GUA CGA AAA CAC CGU UAA Arg His Lys Arg Val Met

  33. RF GCU UAC CAU GCA GUG UUU AUG GUA CGA AAA CAC CGU UAA Arg His Lys Arg Val Met

  34. RF GCU UAC CAU GCA GUG UUU AUG GUA CGA AAA CAC CGU UAA Arg His Lys Arg Val Met

  35. RF GCU UAC CAU GCA GUG UUU AUG GUA CGA AAA CAC CGU UAA Arg His Lys Arg Val Met

  36. RF GCU UAC CAU GCA EIWIT GUG UUU t-RNA-molecylen worden weer voorzien van hun juiste aminozuren AUG GUA CGA AAA CAC CGU UAA Arg His Lys Val Arg Met

  37. Methionine kan afgeknipt worden. EIWIT Arginine Histidine Lysine Valine Arginine Methionine

  38. EIWIT Aan elkaar geschakelde aminozuren Arginine m-RNA codonsAminozuur UAA Stop CGU Arginine CAC Histidine AAA  Lysine CGA  Arginine GUA Valine AUGMethionine / Start Histidine Lysine Valine Arginine

  39. Is het zo makkelijk? Het basisidee werkt zo maar er is meer; http://www.youtube.com/watch?v=bk7PW1FKMTI 1.http://www.youtube.com/watch?v=WsofH466lqk 2.http://www.youtube.com/watch?v=YjWuVrzvZYA 3.http://www.youtube.com/watch?v=FVuAwBGw_pQ 4. http://www.youtube.com/watch?v=5bLEDd-PSTQ