chapter 13 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Chapter 13 PowerPoint Presentation
Download Presentation
Chapter 13

Loading in 2 Seconds...

  share
play fullscreen
1 / 27
Download Presentation

Chapter 13 - PowerPoint PPT Presentation

tarika
128 Views
Download Presentation

Chapter 13

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Chapter 13 From DNA to Protein

  2. From Genes to Proteins • Your traits are determined by proteins that are built according to instructions in DNA. • These sections of DNA are your genes. • The first step in decoding the DNA instructions is to copy part of the DNA into RNA.

  3. 13.1 RNA • Like DNA, RNA consists of a long chain of nucleotides. • 3 main differences between DNA and RNA: • The sugar in RNA is ribose, not deoxyribose. • RNA is single – stranded, while DNA is double – stranded • RNA contains uracil instead of thymine.

  4. 3 Types of RNA: • Messenger RNA (mRNA) – serves as “messengers” from DNA to the rest of the cell. • Ribosomal RNA (rRNA) – make up ribosomes

  5. 3. Transfer RNA (tRNA) – transfers each amino acid to the ribosome. Met Amino Acid tRNA Anticodon A U G

  6. RNA Synthesis: Transcription • Occurs in the nucleus • Copying part of DNA into a complementary sequence in RNA. • Requires an enzyme known as RNA polymerase. • RNA polymerase binds to DNA and separates the DNA strands. • It uses one strand of DNA as a template to make a strand of mRNA.

  7. How does RNA polymerase know where to start? • Promoters – have specific base sequences where RNA polymerase will bind to begin transcription.

  8. Practice • DNA Template strand: TACGGATCCTAAC • Write the corresponding mRNA sequence:

  9. In eukaryotes, many genes are interrupted by introns, which have no coding information. • Exons are the portions of a gene that are translated. • After transcription the introns in the mRNA are cut out by spliceosomes.

  10. 13.2 Ribosomes and Protein Synthesis Translation • The sequence of bases in mRNA serve as instructions for the order of amino acids to produce proteins (polypeptides).

  11. Steps of Translation: • mRNA transcribed from DNA moves to the cytoplasm. • mRNA attaches to a ribosome.

  12. As mRNA moves across the ribosome the proper amino acid is attached to the growing amino acid chain. • This is the job of tRNA

  13. A peptide bond forms between the amino acids. • until the ribosome reaches a stop codon • releases the amino acid chain.

  14. The Genetic Code • RNA contains 4 bases: adenine, uracil, cytosine, guanine • These 4 letters code for 20 amino acids. • The code is read 3 letters at a time. • Each group of 3 letters is known as a codon.

  15. Separate the following mRNA sequence into codons: • UCGCACGGU

  16. The codon AUG can serve as a “start” codon for protein synthesis (Methionine). There are also 3 “stop” codons which act like a period at the end of a sentence.

  17. Table can be found on p. 367.

  18. Practice Problems • Transcribe and translate the following DNA sequences: • TACGGATATAAGCCGTTAATT mRNA: Protein (polypeptide):

  19. TACAAATGGTTCCTTACAACT mRNA: Protein (polypeptide):

  20. Mutations • Mutations in gametes can be passed on to offspring, but mutations in body cells affect only the individual in which they occur.

  21. Gene Mutations • Point mutation – a single nucleotide change • Insertion • ATCGGA → ATCCGGA • Frameshift Mutations • Deletion • ATCGGA → ATGGA • Substitution • ATCGGA → ACCGGA

  22. Transcribe and translate the following DNA sequence: • TACTATACCTGGACT mRNA: Protein (polypeptide):

  23. Now transcribe and translate that same gene with an insertion mutation: • TACTATACCTGGACCT mRNA: Protein (polypeptide): • How does this protein differ from the original?