tab
Uploaded by
23 SLIDES
624 VIEWS
250LIKES

Single Nucleotide Polymorphism And Association Studies

DESCRIPTION

Single Nucleotide Polymorphism And Association Studies. Stat 115 Dec 12, 2006. Outline. Definition and motivation SNP distribution and characteristics Allele frequency, LD, population stratification SNP discovery (unknown) and genotyping (known) SNP association studies

1 / 23

Download Presentation

Single Nucleotide Polymorphism And Association Studies

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Single Nucleotide PolymorphismAnd Association Studies Stat 115 Dec 12, 2006

  2. Outline • Definition and motivation • SNP distribution and characteristics • Allele frequency, LD, population stratification • SNP discovery (unknown) and genotyping(known) • SNP association studies • Case control studies, and family based association studies • Issues related to association studies

  3. Mode of inheritance

  4. Polymorphism • Polymorphism: sites/genes with “common” variation, less common allele frequency >= 1%, otherwise called rare variant and not polymorphic • First discovered (early 1980): restriction fragment length polymorphism • Some definitions: • Locus: position on chromosome where sequence or gene is located • Allele: alternative form of DNA on a locus

  5. Fundamental rules of genetics • Law of Segregation: a diploid parent is equally likely to pass along either of its two alleles P(pass copy 1) = P(pass copy 2) = ½ • Law of Random Union gametes unite in a random fashion, so allele A1 is no more likely to unite with allele A1 than A2, for example P(offspring is A1A1) = P(father passes A1) × P(mother passes A1) P(offspring is A1A2) = P(father passes A1) × P(mother passes A2)+ P(mother passes A1) × P(father passes A2) Slides from Karin S. Dorman

  6. Hardy-Weinberg Equilibrium • Consider a single locus where there are two alleles segregating in a diploid population. Make the Hardy-Weinberg (HW) assumptions: • No difference in genotype proportions between the sexes. • Synchronous reproduction at discrete points in time (discrete generations) • Infinite population size (so that small variabilities are erased in the average) • No mutation. • No migration • No selection • Random mating Slides from Karin S. Dorman

  7. Deriving HWE • Let genotypes at generation t be P11(t), P12(t), and P22(t). Then, • Genotype in the next generation will be • And p1(t+1)=p1(t); p2(t+1)=p2(t) • So in one step it returns to the equilibrium! Slides from Karin S. Dorman

  8. A simple example • Consider this “population” Slides from Karin S. Dorman

  9. Slides from Karin S. Dorman

  10. Slides from Karin S. Dorman

  11. SNP • Three classes of polymorphic markers: • Biallelic: SNPs and indels, less informative but more frequent & stable • Multiallelic: micro and mini satellites, more dynamic, high copy number loci have high mutation rate • Combination of above two • Single Nucleotide Polymorphism • Occasionally short (1-3 bp) indels are considered SNPs too • Come from DNA-replication mistake individual germ line cell, then transmitted

  12. ATGGTAAGCCTGAGCTGACTTAGCGT-AT ATGGTAAACCTGAGTTGACTTAGCGTCAT    SNP SNP indel SNPs result from replication errors and DNA damage They are a ‘polymorphic’ bit state at a nucleoside address What are Single Nucleotide Polymorphisms (SNPs)?

  13. Why Should We Care • Personalized Medicine • Aithal et al., 1999, Lancet • Warfarin anticoagulant drug • CYP2C9 gene metabolizes warfarin, CYP2C9*1 (wild type) has two allelic variants: CYP2C9*2 & CYP2C9*3 (both single AA change) • Patients with variant alleles are poor warfarin metabolisers, often at higher risk of bleeding • Disease gene discovery • Association studies • Chromosome aberrations (copy number changes)

  14. Disease resistant population Disease susceptible population Genotype all individuals for thousands of SNPs ATGATTATAG geneX ATGTTTATAG Resistant people all have an ‘A’ at position 4 in geneX, while susceptible people have a ‘T’ (A/T are the SNPs)

  15. SNP Applications in Medicine • Gene discovery and allele mapping • Association-based (drug) candidate • polymorphism testing of a trait pool • Diagnostics / risk profiling • Drug response prediction • Homogeneity testing / study design • Gene function identification

  16. Population Assignment– assessing competing hypotheses • The likelihood ratio method • Definition of competing hypotheses is essential Adapted from a slide of Steve DiFazio

  17. Adapted from a slide of Steve DiFazio

  18. Hypothesis testing in statistics … • Null hypothesis – assumed true unless there is an overwhelming evidence against it. • P-value – under the null hypothesis assess how “odd” aparticular aspect of the data is – the probability of seeing values as extreme or more extreme than the one we saw. • Using the likelihood ratio to find an effective aspect of the data to tell the two hypotheses apart – a way to guide your choice

  19. SNP Distribution • Most common, > 1 SNP / 1KB • Balance between mutation introduction rate and polymorphism lost rate • Most mutations lost within a few generations • Often more transitions (A/G, C/T) than transversions (A/T, A/C, G/T, G/C) • In non-coding regions, often fewer SNPs at more conserved regions • In coding regions, often more synonymous than non-synonymous SNPs

  20. SNP Characteristics: Allele Frequency Distribution • Most alleles are rare (minor allele frequency < 10%) • Allele frequency in different genomes have a large variation • Human > 1 SNP / 600-1KB, • Fly and maize have an order of magnitude greater number of polymorphism (1 SNP / 50-100 bp) • Nucleotide diversity is positively correlated with recombination rate

  21. International HapMap Project • The International HapMap project is a recent, large-scale effort to facilitate GWAS studies: • Phase 1: 269 samples, 1.1 M SNPs • Phase 2: 270 samples, 3.9 M SNPs • Phase 3: 1115 samples, 1.6 M SNPs • Phase 3 platforms: • Illumina Human1M (by Wellcome Trust Sanger Institute) • Affymetrix SNP 6.0 (by Broad Institute)

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer