iorwen
Uploaded by
23 SLIDES
896 VIEWS
320LIKES

Single Nucleotide Polymorphisms

DESCRIPTION

Single Nucleotide Polymorphisms. Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series. Types of Genetic Variations. Single Nucleotide Polymorphisms (SNP) Single base pair changes GTCA T TCGATT GTCA G TCGATT Indels Small insertion/deletions CTT------GATC

1 / 23

Download Presentation

Single Nucleotide Polymorphisms

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Single Nucleotide Polymorphisms Jennifer Lyon Eskind Biomedical Library May 1, 2009 CRC Workshop Series

  2. Types of Genetic Variations • Single Nucleotide Polymorphisms (SNP) • Single base pair changes GTCATTCGATT GTCAGTCGATT • Indels • Small insertion/deletions CTT------GATC CTTACGGATC • Small variable repeats – microsatellites • ACGACGACGACGACGACG (6 copies) • ACGACGACGACGACGACGACG (7 copies) • Variable Long tandem repeats (can be dozens to hundreds to thousands) • Chromosomal Aberrations: Translocations, Inversions, etc.

  3. Focusing on SNPs • Types of SNPs • SNP nomenclature • Resources for SNPs • Examples and Challenges in Finding SNPs http://learn.genetics.utah.edu/content/health/pharma/snips/

  4. SNPs Types • SNPs can be categorized in a number of ways, the most common are by location and function (relative to a gene) • Intragenic SNPs are often categorized by function – are they in a coding region, an intron, part of the mRNA, outside the mRNA but still in the gene locus (i.e., in the promoter) • Extragenic SNPs may be considered simply ‘genomic’ or might be labeled relative to the nearest gene, ie. 5’ or 3’ to a gene An ‘extragenic’ SNP may affect regulatory regions important in gene expression or other DNA functions such as DNA replication.

  5. SNP Functional Categories • coding nonsynonymous • Missense, nonsense, frame shift • coding synonymous • Intronic • splice site • mRNA utr • 5' utr or 3' utr • (gene) locus region (5’ or 3’ to the gene) • ‘near gene’ usually means within ~2000bp of gene • genomic/extragenic (distant from any gene)

  6. Coding Nonsynonymous SNPs Missense – change an aa http://www.ncbi.nlm.nih.gov/Class/NAWBIS/Modules/Variation/powerpoint/variation_files/frame.html

  7. Coding Non-Synonymous SNPs • Nonsense • Change an aa to a stop codon • Results in a shortened protein • Frame Shift • Are really single-base indels • Drop or add one base and the triplet reading frame is thrown out of shift, altering all downstream aa’s and usually resulting in an earlier stop codon

  8. SNP Nomenclature • The Human Genome Variation Society (http://www.hgvs.org/mutnomen/recs.html) has proposed some guidelines for SNP nomenclature, but at the moment, there is minimal consistency. • Different sources will refer to the same SNP in different ways • While dbSNP identifiers (rs#12345678) are becoming common, they are not required of publishing authors and not used in all cases.

  9. SNPs at Base-Pair Level • The base-pair change is given in various forms: A/C T→G C>T 432G>C T73C The HGVS nomenclature recommendations: "c." for a coding DNA sequence (like  c.76A>T) "g." for a genomic sequence (like g.476A>T) "m." for a mitochondrial sequence (like m.8993T>C "r." for an RNA sequence (like r.76a>u)

  10. Position, position, position! • The big issue with SNPs is identifying their location (numerically). • Position can be specified: • Number location within a specific sequence • Relative to another genetic landmark • Start site for a coding region of a gene • Start or end of an exon or intron • Relative to a marker • Published articles are not always clear on this!!! • Different resources may use different landmarks/numbering • Numbering is always relative to the chosen sequence

  11. Coding SNPs • These are easier because they can be identified by the amino acid position rather than the base-pair position • Most common nomenclature uses either 3-letter or single amino acid codes: Asn332Asp OR A95V • The HGVS recommendation is similar: "p." for a protein sequence (like  p.Lys76Asn) • Amino Acid (protein) coding sequence positions becoming more consistent, but are not always consistent

  12. Database of SNPs (dbSNP) dbSNP • is the international central repository for both single base nucleotide substitutions and short deletion and insertion polymorphisms • accepts data submissions from scientists • is integrated with the NCBI’s Entrez system

  13. dbSNP Content The SNP database has two major classes of content: • Submitted data, i.e., original observations of sequence variation: Submitted SNPs (SS) with ss# (ss 5586300) • Computed/curated data: Reference SNP Clusters (Ref SNP) with rs# (rs 4986582)

  14. Reference SNP Clusters • Ref SNP clusters are computer-generated and curated by NCBI staff • Ref SNP Clusters define a non-redundant set of SNPs • All individual SNPs submitted by a researcher are given a submitter SNP number (ss#) and then redundant (repetitive) submitter SNPs are combined into a RefSNP cluster record, with a unique rs# • Ref SNP clusters may contain multiple submitted SNPs

  15. Searching dbSNP • dbSNP is searched like any other Entrez db • Specialized fields include:

  16. SNP Limits Page

  17. Creating a Complex Search Retrieve all synonymous coding reference SNPs for the human norepinephrine transporter gene (Slc6a2) from dbSNP Search Strategy: human[orgn] AND Slc6a2[gene] AND “coding synonymous” [FUNC] Note: To use the [gene] (gene name) field, it is necessary to have the official gene name or gene symbol as per the Human Gene Nomenclature Committee. Entrez Gene can be used to find these.

  18. dbSNP Output – Graphical Display

  19. dbSNP - Live • Let’s look at a dbSNP reference SNP page: • http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=3743788

  20. Finding SNPs - Challenges • If rs# is available – start with it • Not all rs#s have information in all databases • Another database of interest is the Online Mendelian Inheritance in Man (OMIM) • OMIM doesn’t always provide rs#s even when there is one • dbSNP records may link to OMIM or may not, even if the SNP is in an OMIM record

  21. Example 1 • rs1800888 • (C>T) → Ile164Thr in ADRB2 gene • HGVS nomenclature • NP_000015.1:p.T164I To Find in OMIM • Search with rs1800888 – yield nothing • Search with ADRB2[gene] – find record • Look at allelic variants: .0003 BETA-2-ADRENORECEPTOR AGONIST, REDUCED RESPONSE TO [ADRB2, THR164ILE ] • It is a match

  22. Example 2 • rs2740574 • A/G SNP located 5’ to CYP3A4 • HGVS nomenclature: • NT_007933.14:g.24616372C>T To find in OMIM • Search with rs2740574 yields nothing • Search with gene name CYP3A4 – find record • Find list of allelic variants - .0001 CYP3A4 PROMOTER POLYMORPHISM [CYP3A4, a-g PROMOTER] • Compare info in dbSNP to info in OMIM (look at sequence)

  23. Other Databases • OMIM – NCBI • HapMap - International HapMap Project • ALFRED – Allele Frequence Databases • HGVbaseG2P - Human Genome Variation database of Genotype-to-Phenotype information • PharmGKB – Pharmacogenomics Knowledgebase • F-SNP – Functional SNPs

More Related